Transcript: Mouse NM_001033328.2

Mus musculus transmembrane protein 185A (Tmem185a), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Tmem185a (236848)
Length:
1989
CDS:
29..997

Additional Resources:

NCBI RefSeq record:
NM_001033328.2
NBCI Gene record:
Tmem185a (236848)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033328.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251666 TGCGCTCTATGGATGTGATTG pLKO_005 534 CDS 100% 10.800 15.120 N Tmem185a n/a
2 TRCN0000265214 TACATCGTTTGGTCGGTTCTG pLKO_005 509 CDS 100% 4.050 5.670 N Tmem185a n/a
3 TRCN0000251663 ACAACGCAGAACACATATAAC pLKO_005 559 CDS 100% 13.200 9.240 N Tmem185a n/a
4 TRCN0000423680 GGGCTGTCTTTGCTCCAATAT pLKO_005 150 CDS 100% 13.200 9.240 N TMEM185A n/a
5 TRCN0000251664 CATTGTCGTGCCTCTTCTTAC pLKO_005 601 CDS 100% 10.800 7.560 N Tmem185a n/a
6 TRCN0000251665 TGTCCCTCTGTGGATTCTCAT pLKO_005 460 CDS 100% 4.950 3.465 N Tmem185a n/a
7 TRCN0000428124 TTCGTTTGGATGGCATCATAC pLKO_005 117 CDS 100% 10.800 7.560 N TMEM185A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033328.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09200 pDONR223 100% 83.4% 91.7% None (many diffs) n/a
2 ccsbBroad304_09200 pLX_304 0% 83.4% 91.7% V5 (many diffs) n/a
3 TRCN0000469221 TTGGTGATGGAAGCTAACGGAAGT pLX_317 26.7% 83.4% 91.7% V5 (many diffs) n/a
4 ccsbBroadEn_10518 pDONR223 100% 74.3% 81.4% None (many diffs) n/a
5 ccsbBroad304_10518 pLX_304 0% 74.3% 81.4% V5 (many diffs) n/a
6 TRCN0000475283 TATGCATTGACCTGAGATATCGAT pLX_317 43.1% 74.3% 81.4% V5 (many diffs) n/a
7 ccsbBroadEn_14310 pDONR223 100% 46.6% 52.7% None (many diffs) n/a
8 ccsbBroad304_14310 pLX_304 0% 46.6% 52.7% V5 (many diffs) n/a
9 TRCN0000479165 CGTTTGGGAGTTTCCAGATCTTGG pLX_317 70.8% 46.6% 52.7% V5 (many diffs) n/a
Download CSV