Transcript: Mouse NM_025824.3

Mus musculus basic leucine zipper and W2 domains 1 (Bzw1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Bzw1 (66882)
Length:
2833
CDS:
92..1351

Additional Resources:

NCBI RefSeq record:
NM_025824.3
NBCI Gene record:
Bzw1 (66882)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025824.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096897 CCTTAATGCATCCATTCTTAA pLKO.1 577 CDS 100% 13.200 18.480 N Bzw1 n/a
2 TRCN0000312065 CCTTAATGCATCCATTCTTAA pLKO_005 577 CDS 100% 13.200 18.480 N Bzw1 n/a
3 TRCN0000147812 GCAGTAGCTAAGTTTCTTGAT pLKO.1 236 CDS 100% 4.950 6.930 N BZW1 n/a
4 TRCN0000096896 CCATTCTTAACAGCCTTTATA pLKO.1 588 CDS 100% 15.000 10.500 N Bzw1 n/a
5 TRCN0000312120 CCATTCTTAACAGCCTTTATA pLKO_005 588 CDS 100% 15.000 10.500 N Bzw1 n/a
6 TRCN0000096895 CCCATTCTGAAGTGGTATAAA pLKO.1 1217 CDS 100% 15.000 10.500 N Bzw1 n/a
7 TRCN0000312121 CCCATTCTGAAGTGGTATAAA pLKO_005 1217 CDS 100% 15.000 10.500 N Bzw1 n/a
8 TRCN0000433363 CTCAGTTTCAAGACTGTATTA pLKO_005 180 CDS 100% 13.200 9.240 N BZW1 n/a
9 TRCN0000425630 ACTGTATTATTCAAGGCTTAA pLKO_005 192 CDS 100% 10.800 7.560 N BZW1 n/a
10 TRCN0000379243 TAAACAAAGTGTTGAGCATTT pLKO_005 757 CDS 100% 10.800 7.560 N Bzw1 n/a
11 TRCN0000377034 CCAGTGGTCATTGGGATAGTC pLKO_005 959 CDS 100% 4.950 3.465 N Bzw1 n/a
12 TRCN0000147346 GCAGAAACACTCTTTGACATT pLKO.1 290 CDS 100% 4.950 3.465 N BZW1 n/a
13 TRCN0000429223 TGGTACACTGGCAGATGACAT pLKO_005 340 CDS 100% 4.950 3.465 N BZW1 n/a
14 TRCN0000096898 GACTGTATTATTCAAGGCTTA pLKO.1 191 CDS 100% 4.050 2.835 N Bzw1 n/a
15 TRCN0000096894 CCCTATATCAAGCATGATATA pLKO.1 1441 3UTR 100% 1.320 0.924 N Bzw1 n/a
16 TRCN0000363710 CCCTATATCAAGCATGATATA pLKO_005 1441 3UTR 100% 1.320 0.924 N Bzw1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025824.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11404 pDONR223 100% 92.6% 100% None (many diffs) n/a
2 ccsbBroad304_11404 pLX_304 0% 92.6% 100% V5 (many diffs) n/a
3 TRCN0000469255 GCAGAAGTTCGCACTTAGGCTCTG pLX_317 39.7% 92.6% 100% V5 (many diffs) n/a
Download CSV