Construct: ORF TRCN0000469418
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009566.1_s317c1
- Derived from:
- ccsbBroadEn_07929
- DNA Barcode:
- ATTAATCTTAGCCAAAAATGCGCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PPIL2 (23759)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469418
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 23759 | PPIL2 | peptidylprolyl isomerase li... | NM_148176.2 | 99.9% | 100% | 711C>T |
| 2 | human | 23759 | PPIL2 | peptidylprolyl isomerase li... | NM_001317996.1 | 98.1% | 93.2% | 711C>T;1467_1470delGAAG;1560_1561ins25 |
| 3 | human | 23759 | PPIL2 | peptidylprolyl isomerase li... | NM_014337.4 | 98.1% | 93.2% | 711C>T;1467_1470delGAAG;1560_1561ins25 |
| 4 | human | 23759 | PPIL2 | peptidylprolyl isomerase li... | NM_148175.3 | 98.1% | 93.2% | 711C>T;1467_1470delGAAG;1560_1561ins25 |
| 5 | human | 23759 | PPIL2 | peptidylprolyl isomerase li... | XM_005261448.4 | 98.1% | 93.2% | 711C>T;1467_1470delGAAG;1560_1561ins25 |
| 6 | human | 23759 | PPIL2 | peptidylprolyl isomerase li... | XM_011530046.3 | 98.1% | 93.2% | 711C>T;1467_1470delGAAG;1560_1561ins25 |
| 7 | human | 23759 | PPIL2 | peptidylprolyl isomerase li... | XM_011530047.3 | 98.1% | 93.2% | 711C>T;1467_1470delGAAG;1560_1561ins25 |
| 8 | human | 23759 | PPIL2 | peptidylprolyl isomerase li... | XM_011530044.3 | 96.3% | 96.6% | (many diffs) |
| 9 | human | 23759 | PPIL2 | peptidylprolyl isomerase li... | XM_011530043.3 | 91.7% | 91.7% | 711C>T;1561_1562insGCAG;1578_1713del |
| 10 | human | 23759 | PPIL2 | peptidylprolyl isomerase li... | XM_011530042.3 | 91.4% | 91.9% | (many diffs) |
| 11 | human | 23759 | PPIL2 | peptidylprolyl isomerase li... | XM_011530041.3 | 85.3% | 84.9% | (many diffs) |
| 12 | human | 23759 | PPIL2 | peptidylprolyl isomerase li... | XM_024452193.1 | 77.2% | 73.1% | (many diffs) |
| 13 | human | 23759 | PPIL2 | peptidylprolyl isomerase li... | XM_011530049.2 | 56.4% | 56% | (many diffs) |
| 14 | human | 23759 | PPIL2 | peptidylprolyl isomerase li... | XM_011530050.2 | 56.4% | 56% | (many diffs) |
| 15 | human | 23759 | PPIL2 | peptidylprolyl isomerase li... | XM_011530051.2 | 56.4% | 56% | (many diffs) |
| 16 | human | 23759 | PPIL2 | peptidylprolyl isomerase li... | XM_017028706.2 | 50% | 45.3% | 0_1ins762;705_708delGAAG;798_799ins25 |
| 17 | human | 23759 | PPIL2 | peptidylprolyl isomerase li... | XM_017028705.1 | 44.1% | 43.6% | (many diffs) |
| 18 | mouse | 66053 | Ppil2 | peptidylprolyl isomerase (c... | NM_001252444.1 | 84.4% | 85% | (many diffs) |
| 19 | mouse | 66053 | Ppil2 | peptidylprolyl isomerase (c... | NM_001252445.1 | 84.4% | 85% | (many diffs) |
| 20 | mouse | 66053 | Ppil2 | peptidylprolyl isomerase (c... | NM_144954.3 | 84.4% | 85% | (many diffs) |
| 21 | mouse | 66053 | Ppil2 | peptidylprolyl isomerase (c... | XM_006522447.3 | 80.6% | 82.9% | (many diffs) |
| 22 | mouse | 66053 | Ppil2 | peptidylprolyl isomerase (c... | XM_006522443.3 | 79.4% | 79.7% | (many diffs) |
| 23 | mouse | 66053 | Ppil2 | peptidylprolyl isomerase (c... | XM_006522444.3 | 55.4% | 54.6% | (many diffs) |
| 24 | mouse | 66053 | Ppil2 | peptidylprolyl isomerase (c... | XM_006522445.3 | 55.4% | 54.6% | (many diffs) |
| 25 | mouse | 66053 | Ppil2 | peptidylprolyl isomerase (c... | XM_006522446.3 | 55.4% | 54.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1647
- ORF length:
- 1581
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg gaagcgacag caccaaaagg acaaaatgta cattacctgt gctgaataca 121 ctcactttta tggtggcaag aagccagatc tcccacaaac aaattttcgt cgtttacctt 181 ttgaccactg cagtctctct ctgcagccct ttgtctaccc agtctgcact cccgatggca 241 tcgtctttga cttactgaac attgttccat ggcttaagaa gtacgggacc aaccccagca 301 atggagagaa gctggacggg aggtccctga tcaagctgaa cttttccaag aacagtgagg 361 ggaagtacca ctgcccagtg ctgtttaccg tgttcaccaa caacacccac atcgtggctg 421 tgaggacgac cggcaacgtc tacgcctatg aggcagtgga acagctaaat atcaaggcca 481 agaacttccg ggacctgctg accgacgagc ccttctcccg gcaggacatc atcaccctcc 541 aggaccccac caatttggac aagttcaatg tctctaactt ctatcatgtg aagaataaca 601 tgaaaataat agacccagat gaagagaagg ccaaacagga cccgtcttat tatctgaaaa 661 atacaaatgc cgagacccga gagaccctgc aggagctcta caaggagttc aaaggggacg 721 agattctggc agccaccatg aaggccccgg agaagaagaa agtggacaag ctgaatgctg 781 cccactattc cacagggaag gtcagcgctt ccttcacctc caccgcgatg gtcccggaga 841 ccacacatga agcagctgcc atcgacgagg atgtgctgcg ctaccagttt gtgaagaaga 901 agggctacgt gcggctgcac accaacaagg gcgacctcaa cctggagctg cactgcgacc 961 tgacaccaaa aacctgcgaa aacttcatca ggctttgcaa gaagcattat tacgatggca 1021 ccatcttcca cagatccatc cggaactttg tgatccaagg gggcgacccc acaggcacag 1081 gcacgggtgg ggagtcatac tgggggaagc ccttcaaaga cgagttccgg cccaacctct 1141 cgcacacggg ccgcggcatc ctcagcatgg ccaactccgg gcccaacagc aacaggtctc 1201 aattcTTCAT CACGTTTCGC TCCTGTGCCT ACCTGGACAA GAAGCATACC ATCTTTGGAC 1261 GGGTTGTTGG GGGCTTTGAC GTACTGACAG CCATGGAGAA TGTGGAGAGT GACCCCAAAA 1321 CTGACCGCCC TAAGGAGGAG ATCCGCATTG ATGCCACTAC AGTGTTCGTG GACCCCTATG 1381 AGGAGGCCGA TGCCCAGATT GCGCAGGAGC GGAAGACACA GCTCAAGGTA GCCCCGGAGA 1441 CCAAAGTGAA GAGCAGCCAG CCCCAGGCAG GGAGCCAGGG CCCCCAGACC TTCCGCCAGG 1501 GCGTGGGCAA GTACATCAAC CCAGCAGCCA CCGAGCAGCA GAGGAAGAGC CCTCAACCAG 1561 TGCCACTGTC CCCATGTCCA AGAAGAAGCC CAGTCGGGGT TTTGGGGACT TCAGCTCCTG 1621 GTAGCAGCAG GCTGCCTGAT GACCACTACC CAACTTTCTT GTACAAAGTG GTTGATATCG 1681 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1741 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GAATTAATCT 1801 TAGCCAAAAA TGCGCAACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1861 aagatt