Transcript: Mouse NM_001372468.1

Mus musculus single stranded DNA binding protein 4 (Ssbp4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Mus musculus (mouse)
Gene:
Ssbp4 (76900)
Length:
1675
CDS:
135..1382

Additional Resources:

NCBI RefSeq record:
NM_001372468.1
NBCI Gene record:
Ssbp4 (76900)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001372468.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108593 TGTCTGAGATCCGTTGGGAAA pLKO.1 256 CDS 100% 4.050 3.240 N Ssbp4 n/a
2 TRCN0000335102 TGTCTGAGATCCGTTGGGAAA pLKO_005 256 CDS 100% 4.050 3.240 N Ssbp4 n/a
3 TRCN0000348423 CGCTGTATGTATATGAGTATC pLKO_005 196 CDS 100% 10.800 7.560 N Ssbp4 n/a
4 TRCN0000108594 CGAGAATATGTACACCATCAT pLKO.1 926 CDS 100% 4.950 3.465 N Ssbp4 n/a
5 TRCN0000335178 CGAGAATATGTACACCATCAT pLKO_005 926 CDS 100% 4.950 3.465 N Ssbp4 n/a
6 TRCN0000108590 GCGCTGTATGTATATGAGTAT pLKO.1 195 CDS 100% 4.950 3.465 N Ssbp4 n/a
7 TRCN0000108591 CAGCGAGAATATGTACACCAT pLKO.1 923 CDS 100% 2.640 1.848 N Ssbp4 n/a
8 TRCN0000108592 CCAGGGCTATGGAACTGGCAT pLKO.1 698 CDS 100% 0.880 0.616 N Ssbp4 n/a
9 TRCN0000016384 CGGGACCTTCCTGCACCCGTT pLKO.1 1247 CDS 100% 0.000 0.000 N SSBP4 n/a
10 TRCN0000348499 ATGACCATGAGCGTGTGATAG pLKO_005 1409 3UTR 100% 10.800 5.400 Y Ssbp4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001372468.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05152 pDONR223 100% 70.4% 71.9% None (many diffs) n/a
2 ccsbBroad304_05152 pLX_304 0% 70.4% 71.9% V5 (many diffs) n/a
3 TRCN0000469420 AAAGTTTCTCCCGTAGGGTCGAAC pLX_317 37.8% 70.4% 71.9% V5 (many diffs) n/a
Download CSV