Construct: ORF TRCN0000470021
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014817.1_s317c1
- Derived from:
- ccsbBroadEn_15775
- DNA Barcode:
- AGCGAGACGGGAACTCCTATTCAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CNOT10 (25904)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470021
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 25904 | CNOT10 | CCR4-NOT transcription comp... | NM_001256741.2 | 99.9% | 99.8% | 2125C>T |
| 2 | human | 25904 | CNOT10 | CCR4-NOT transcription comp... | XM_017006112.2 | 98.2% | 98% | 1759_1760ins36;2089C>T |
| 3 | human | 25904 | CNOT10 | CCR4-NOT transcription comp... | XM_017006109.2 | 96.4% | 96.2% | 1515_1592del;2203C>T |
| 4 | human | 25904 | CNOT10 | CCR4-NOT transcription comp... | NM_015442.3 | 96.3% | 96.1% | 1515_1595del;2206C>T |
| 5 | human | 25904 | CNOT10 | CCR4-NOT transcription comp... | XM_017006111.2 | 94.8% | 94.4% | 1515_1592del;1837_1838ins36;2167C>T |
| 6 | human | 25904 | CNOT10 | CCR4-NOT transcription comp... | XM_017006110.2 | 94.7% | 94.3% | 1515_1595del;1840_1841ins36;2170C>T |
| 7 | human | 25904 | CNOT10 | CCR4-NOT transcription comp... | XM_011533566.2 | 91.7% | 91.5% | (many diffs) |
| 8 | human | 25904 | CNOT10 | CCR4-NOT transcription comp... | XM_006713084.3 | 88.7% | 88.4% | (many diffs) |
| 9 | human | 25904 | CNOT10 | CCR4-NOT transcription comp... | NM_001256742.1 | 88.6% | 88.3% | (many diffs) |
| 10 | human | 25904 | CNOT10 | CCR4-NOT transcription comp... | XM_006713085.3 | 87.1% | 86.6% | (many diffs) |
| 11 | human | 25904 | CNOT10 | CCR4-NOT transcription comp... | XR_001740089.1 | 73.4% | (many diffs) | |
| 12 | human | 25904 | CNOT10 | CCR4-NOT transcription comp... | NR_046352.2 | 71% | (many diffs) | |
| 13 | human | 25904 | CNOT10 | CCR4-NOT transcription comp... | XM_011533567.2 | 65.6% | 65.4% | 0_1ins684;831_911del;1522C>T |
| 14 | mouse | 78893 | Cnot10 | CCR4-NOT transcription comp... | XM_006512399.3 | 85.4% | 92.5% | (many diffs) |
| 15 | mouse | 78893 | Cnot10 | CCR4-NOT transcription comp... | NM_153585.5 | 85.3% | 92.4% | (many diffs) |
| 16 | mouse | 78893 | Cnot10 | CCR4-NOT transcription comp... | XM_017313699.1 | 83.7% | 90.7% | (many diffs) |
| 17 | mouse | 78893 | Cnot10 | CCR4-NOT transcription comp... | XR_871264.2 | 70.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2217
- ORF length:
- 2151
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc tgcagacaag cctgcagatc agggagcaga gaaacatgaa ggcacaggtc 121 agtcctctgg gatcactgat caagagaagg agttatccac caatgctttc caagctttca 181 catctggaaa ttatgatgcc tgtctacaac accttgcctg tctacaagat ataaacaaag 241 atgattataa aataattttg aatacagcag tagctgagtt ttttaaaagt aaccaaacaa 301 caacagataa tttgagacaa acacttaacc agctgaagaa tcaggtccac tcagctgttg 361 aagaaatgga tggattagat gatgttgaaa acagcatgtt gtactataat caagcagtca 421 ttctttatca tctgcggcag tatacagaag ccatatcagt tggtgaaaaa ctttatcagt 481 tcatagagcc ttttgaagaa aaatttgccc aagcagtgtg ttttttgctt gtagacctgt 541 atatattaac ctaccaagct gagaaagctt tgcatcttct tgctgtccta gaaaaaatga 601 tttcacaggg taacaataac aaaaatggaa agaatgagac tggtaataac aacaacaaag 661 atggatctaa tcataaagct gaaagtggag ctctaataga agctgcaaaa tcaaagatac 721 atcagtacaa agtacgagct tatatccaaa tgaagtctct gaaagcatgt aaaagggaaa 781 tcaagtcagt catgaataca gctggaaatt ccgcaccctc tctctttctt aaaagcaatt 841 ttgagtactt aagaggtaat tatcgaaaag ccgtgaagct attaaatagt tcaaacattg 901 ctgagcatcc aggattcatg aaaacaggtg aatgcttgag atgcatgttc tggaataacc 961 ttggttgcat ccattttgcc atgagcaagc acaatttggg aatattctac tttaaaaagg 1021 ctctgcaaga gaatgacaat gtctgtgcac agctcagtgc aggtagcact gatccaggta 1081 aaaaattttc aggaagaccc atgtgtacgt tactaaccaa taagagatat gagttgctgt 1141 ataactgtgg aattcagctt cttcacattg gaaggcctct tgctgccttc gaatgtctga 1201 ttgaagctgt tcaggtttat catgcaaatc ctcgcctctg gctacggctg gctgaatgct 1261 gcattgctgc caataagggg acttctgaac aagaaactaa aggccttccc agcaaaaaag 1321 gaattgtaca gtctattgtt ggtcaaggct atcatcgtaa aatagttttg gcatcacagt 1381 ctatacagaa tactgtttat aatgatgggc agtcttcggc cattcctgta gccagtatgg 1441 agtttgcagc catatgtctc agaaatgcct tgttgctgct acctgaagaa cagcaagatc 1501 caaagcagga aaatggggct aaaaatagta atcaattagg tgggaacaca gagagcagcg 1561 aaagcagtga aacttgcagg tgctccatac ttgcttgcag tgcctacgtg gctctggctt 1621 tgggtgataa cctcatggct ttgaatcatg cagataaact tcttcagcag cccaagctgt 1681 caggatctct taagtttttg ggacatttat atgctgcaga agccctcatc tctctcgaca 1741 gaatatctga tgccattact cacttgaacc cggagaatgt cactgatgtc tccttaggga 1801 tctcttcaaa tgagcaggac caaggatcag acaaaggtga aaatgaagca atggaatccT 1861 CTGGTAAGCG GGCCCCTCAG TGCTACCCCA GTTCCGTCAA CTCTGCCAGG ACTGTGATGC 1921 TGTTCAACCT TGGCAGCGCT TACTGCCTGA GGAGCGAATA TGACAAAGCC CGAAAGTGTC 1981 TCCACCAGGC GGCTTCAATG ATCCATCCTA AAGAGGTGCC CCCTGAGGCC ATCTTGCTGG 2041 CAGTCTACCT TGAACTGCAG AATGGTAATA CTCAGCTGGC CTTACAGATC ATCAAAAGGA 2101 ATCAGCTGCT CCCTGCAGTG AAAACACACT CTGAAGTGAG AAAGAAGCCA GTGTTTCAGC 2161 CTGTCCACCC GATCCAGCCC ATCCAAATGT CGGCTTTCAC CACTGTGCAG AGAAAGTGCC 2221 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 2281 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 2341 ATATATCTTG TGGAAAGGAC GAAGCGAGAC GGGAACTCCT ATTCACACGC GTTAAGTCga 2401 caatcaacct ctggattaca aaatttgtga aagatt