Transcript: Mouse XR_871264.2

PREDICTED: Mus musculus CCR4-NOT transcription complex, subunit 10 (Cnot10), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cnot10 (78893)
Length:
2381
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_871264.2
NBCI Gene record:
Cnot10 (78893)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_871264.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201465 CAAGCTGTCTGGCTCTCTTAA pLKO.1 1970 3UTR 100% 13.200 10.560 N Cnot10 n/a
2 TRCN0000250229 GGTCAGGGATATCACCGTAAA pLKO_005 1557 3UTR 100% 10.800 8.640 N Cnot10 n/a
3 TRCN0000192597 GTCTATTGTTGGTCAGGGATA pLKO.1 1547 3UTR 100% 4.050 3.240 N Cnot10 n/a
4 TRCN0000250230 TGCTGCATTGCTGCCAATAAA pLKO_005 1473 3UTR 100% 15.000 10.500 N Cnot10 n/a
5 TRCN0000250231 TTGCCTGTCTCCAAGATATAA pLKO_005 430 3UTR 100% 15.000 10.500 N Cnot10 n/a
6 TRCN0000190628 GCCTTCGAGTGTCTGATTGAA pLKO.1 1401 3UTR 100% 5.625 3.938 N Cnot10 n/a
7 TRCN0000250228 GGCTCTGGCCTTAGGTGATAA pLKO_005 1907 3UTR 100% 13.200 7.920 N Cnot10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_871264.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07962 pDONR223 100% 73.2% None (many diffs) n/a
2 ccsbBroad304_07962 pLX_304 0% 73.2% V5 (many diffs) n/a
3 TRCN0000471019 ACATAGGAGTATCCCGAGGAAAGA pLX_317 16.4% 73.2% V5 (many diffs) n/a
4 ccsbBroadEn_15775 pDONR223 0% 70.3% None (many diffs) n/a
5 ccsbBroad304_15775 pLX_304 0% 70.3% V5 (many diffs) n/a
6 TRCN0000470021 AGCGAGACGGGAACTCCTATTCAC pLX_317 16.9% 70.3% V5 (many diffs) n/a
Download CSV