Transcript: Human NM_015442.3

Homo sapiens CCR4-NOT transcription complex subunit 10 (CNOT10), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
CNOT10 (25904)
Length:
2772
CDS:
274..2508

Additional Resources:

NCBI RefSeq record:
NM_015442.3
NBCI Gene record:
CNOT10 (25904)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015442.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418734 TACTGCCTGAGGAGCGAATAT pLKO_005 2230 CDS 100% 13.200 18.480 N CNOT10 n/a
2 TRCN0000162623 CGACAGAATATCTGATGCCAT pLKO.1 2025 CDS 100% 2.640 3.696 N CNOT10 n/a
3 TRCN0000420823 GGTCAAGGCTATCATCGTAAA pLKO_005 1549 CDS 100% 10.800 8.640 N CNOT10 n/a
4 TRCN0000158683 GATGGTGAAGGCTGTTAATTT pLKO.1 2594 3UTR 100% 15.000 10.500 N CNOT10 n/a
5 TRCN0000416661 TGAGTACTTAAGAGGTAATTA pLKO_005 1050 CDS 100% 15.000 10.500 N CNOT10 n/a
6 TRCN0000429776 ACAGCATGTTGTACTATAATC pLKO_005 599 CDS 100% 13.200 9.240 N CNOT10 n/a
7 TRCN0000418998 CAAAGATGGATCTAATCATAA pLKO_005 864 CDS 100% 13.200 9.240 N CNOT10 n/a
8 TRCN0000159399 GCAAGCACAATTTGGGAATAT pLKO.1 1193 CDS 100% 13.200 9.240 N CNOT10 n/a
9 TRCN0000434797 GCTGAAAGTGGAGCTCTAATA pLKO_005 886 CDS 100% 13.200 9.240 N CNOT10 n/a
10 TRCN0000158957 GTATCACAGCAGAATGAATAA pLKO.1 2571 3UTR 100% 13.200 9.240 N CNOT10 n/a
11 TRCN0000160015 CAGTACAAAGTACGAGCTTAT pLKO.1 931 CDS 100% 10.800 7.560 N CNOT10 n/a
12 TRCN0000159618 GCTTCAATGATCCATCCTAAA pLKO.1 2281 CDS 100% 10.800 7.560 N CNOT10 n/a
13 TRCN0000416247 TAACCTTGGTTGCATCCATTT pLKO_005 1164 CDS 100% 10.800 7.560 N CNOT10 n/a
14 TRCN0000159741 GTTGTATCACAGCAGAATGAA pLKO.1 2568 3UTR 100% 5.625 3.938 N CNOT10 n/a
15 TRCN0000162039 CGAATATGACAAAGCCCGAAA pLKO.1 2244 CDS 100% 4.050 2.835 N CNOT10 n/a
16 TRCN0000250230 TGCTGCATTGCTGCCAATAAA pLKO_005 1465 CDS 100% 15.000 10.500 N Cnot10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015442.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07962 pDONR223 100% 99.9% 100% None 1344G>T n/a
2 ccsbBroad304_07962 pLX_304 0% 99.9% 100% V5 1344G>T n/a
3 TRCN0000471019 ACATAGGAGTATCCCGAGGAAAGA pLX_317 16.4% 99.9% 100% V5 1344G>T n/a
4 ccsbBroadEn_15775 pDONR223 0% 96.3% 96.1% None 1515_1595del;2206C>T n/a
5 ccsbBroad304_15775 pLX_304 0% 96.3% 96.1% V5 1515_1595del;2206C>T n/a
6 TRCN0000470021 AGCGAGACGGGAACTCCTATTCAC pLX_317 16.9% 96.3% 96.1% V5 1515_1595del;2206C>T n/a
Download CSV