Transcript: Human XM_017006111.2

PREDICTED: Homo sapiens CCR4-NOT transcription complex subunit 10 (CNOT10), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CNOT10 (25904)
Length:
2723
CDS:
264..2459

Additional Resources:

NCBI RefSeq record:
XM_017006111.2
NBCI Gene record:
CNOT10 (25904)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006111.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418734 TACTGCCTGAGGAGCGAATAT pLKO_005 2181 CDS 100% 13.200 18.480 N CNOT10 n/a
2 TRCN0000162623 CGACAGAATATCTGATGCCAT pLKO.1 2012 CDS 100% 2.640 3.696 N CNOT10 n/a
3 TRCN0000420823 GGTCAAGGCTATCATCGTAAA pLKO_005 1539 CDS 100% 10.800 8.640 N CNOT10 n/a
4 TRCN0000158683 GATGGTGAAGGCTGTTAATTT pLKO.1 2545 3UTR 100% 15.000 10.500 N CNOT10 n/a
5 TRCN0000416661 TGAGTACTTAAGAGGTAATTA pLKO_005 1040 CDS 100% 15.000 10.500 N CNOT10 n/a
6 TRCN0000429776 ACAGCATGTTGTACTATAATC pLKO_005 589 CDS 100% 13.200 9.240 N CNOT10 n/a
7 TRCN0000418998 CAAAGATGGATCTAATCATAA pLKO_005 854 CDS 100% 13.200 9.240 N CNOT10 n/a
8 TRCN0000159399 GCAAGCACAATTTGGGAATAT pLKO.1 1183 CDS 100% 13.200 9.240 N CNOT10 n/a
9 TRCN0000434797 GCTGAAAGTGGAGCTCTAATA pLKO_005 876 CDS 100% 13.200 9.240 N CNOT10 n/a
10 TRCN0000158957 GTATCACAGCAGAATGAATAA pLKO.1 2522 3UTR 100% 13.200 9.240 N CNOT10 n/a
11 TRCN0000160015 CAGTACAAAGTACGAGCTTAT pLKO.1 921 CDS 100% 10.800 7.560 N CNOT10 n/a
12 TRCN0000159618 GCTTCAATGATCCATCCTAAA pLKO.1 2232 CDS 100% 10.800 7.560 N CNOT10 n/a
13 TRCN0000416247 TAACCTTGGTTGCATCCATTT pLKO_005 1154 CDS 100% 10.800 7.560 N CNOT10 n/a
14 TRCN0000159741 GTTGTATCACAGCAGAATGAA pLKO.1 2519 3UTR 100% 5.625 3.938 N CNOT10 n/a
15 TRCN0000162039 CGAATATGACAAAGCCCGAAA pLKO.1 2195 CDS 100% 4.050 2.835 N CNOT10 n/a
16 TRCN0000250230 TGCTGCATTGCTGCCAATAAA pLKO_005 1455 CDS 100% 15.000 10.500 N Cnot10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006111.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07962 pDONR223 100% 98.2% 98.1% None 1344G>T;1510_1511insGCA;1837_1838ins36 n/a
2 ccsbBroad304_07962 pLX_304 0% 98.2% 98.1% V5 1344G>T;1510_1511insGCA;1837_1838ins36 n/a
3 TRCN0000471019 ACATAGGAGTATCCCGAGGAAAGA pLX_317 16.4% 98.2% 98.1% V5 1344G>T;1510_1511insGCA;1837_1838ins36 n/a
4 ccsbBroadEn_15775 pDONR223 0% 94.8% 94.4% None 1515_1592del;1837_1838ins36;2167C>T n/a
5 ccsbBroad304_15775 pLX_304 0% 94.8% 94.4% V5 1515_1592del;1837_1838ins36;2167C>T n/a
6 TRCN0000470021 AGCGAGACGGGAACTCCTATTCAC pLX_317 16.9% 94.8% 94.4% V5 1515_1592del;1837_1838ins36;2167C>T n/a
Download CSV