Construct: ORF TRCN0000470249
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015031.1_s317c1
- Derived from:
- ccsbBroadEn_09811
- DNA Barcode:
- ATAGCCCCCTTATCGTCAGGACCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TVP23C (201158)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470249
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 201158 | TVP23C | trans-golgi network vesicle... | NM_145301.2 | 99.8% | 99.6% | 585G>T |
2 | human | 51030 | TVP23B | trans-golgi network vesicle... | NM_016078.6 | 66.1% | 59% | (many diffs) |
3 | human | 201158 | TVP23C | trans-golgi network vesicle... | NM_001135036.1 | 64.1% | 58.2% | (many diffs) |
4 | human | 100533496 | TVP23C-CDRT4 | TVP23C-CDRT4 readthrough | NM_001204478.2 | 57.9% | 54.9% | (many diffs) |
5 | human | 51030 | TVP23B | trans-golgi network vesicle... | NM_001316924.2 | 54.9% | 54.3% | (many diffs) |
6 | human | 51030 | TVP23B | trans-golgi network vesicle... | NM_001316919.1 | 43.6% | 36.5% | (many diffs) |
7 | human | 51030 | TVP23B | trans-golgi network vesicle... | NM_001316920.1 | 43.6% | 36.5% | (many diffs) |
8 | human | 51030 | TVP23B | trans-golgi network vesicle... | NM_001316921.1 | 43.6% | 36.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 894
- ORF length:
- 828
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtt gcagcaggat agtaatgatg acactgaaga tgtttcactg tttgatgcgg 121 aagaggagac gactaataga ccaagaaaag ccaaaatcag acatccagta gcatcgtttt 181 tccacttatt ctttcgagtc agtgcaatca tcgtctgtct tctctgtgag ttgctcagca 241 gcagctttat tacctgtatg gttacaatta tcttgttgtt gtcgtgtgac ttttgggcag 301 tgaagaatgt cacaggtaga ctaatggttg gcctacgttg gtggaatcac attgatgaag 361 atggaaagag ccattgggtg tttgaatcta gaaaggagtc ctctcaagag aataaaactg 421 tgtcagaggc tgaatcaaga atcttttggt tgggacttat tgcctgttca gtactgtggg 481 tgatatttgc ctttagtgca ctcttctcct tcacagtaaa gtggctgaga cggtctcgcc 541 acattgccca gactggtctg aaagtcttgg gctcaagaga tcctcccgct tccgccttcc 601 aaagcgctgg gataacaggc gtgagccgct gcccgggcca tccctcgagt aagtttcatc 661 aggtagacat taattctttc acgaggatca cggatcgagc tctttactgg aaacctgcgc 721 cccgccttag ttctccacct cttcgtgcgg ctccaggcaa ctgccaacag atggcGCCCG 781 CCCGCCTATT TCTCTCCTTG CGGCTTTGGG CCTGGAGGGG AGGTGGGGAG AGTCCCAATA 841 GCAGAGGAAC TGGTGAGCCC GGGCCAAAAT TTCATCTGGC ATCCGGAATG CATTACCCAA 901 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 961 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1021 TATCTTGTGG AAAGGACGAA TAGCCCCCTT ATCGTCAGGA CCGACGCGTT AAGTCgacaa 1081 tcaacctctg gattacaaaa tttgtgaaag att