Transcript: Human NM_004640.7

Homo sapiens DExD-box helicase 39B (DDX39B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
DDX39B (7919)
Length:
1681
CDS:
187..1473

Additional Resources:

NCBI RefSeq record:
NM_004640.7
NBCI Gene record:
DDX39B (7919)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004640.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000307312 CCTAGCCCTGGCTCGAAATAA pLKO_005 714 CDS 100% 15.000 7.500 Y DDX39B n/a
2 TRCN0000074383 CCTCAACCTCAAACACATTAA pLKO.1 738 CDS 100% 13.200 6.600 Y DDX39B n/a
3 TRCN0000286976 CCTCAACCTCAAACACATTAA pLKO_005 738 CDS 100% 13.200 6.600 Y DDX39B n/a
4 TRCN0000294330 GGATCGCTTTGAGGTCAATAT pLKO_005 1398 CDS 100% 13.200 6.600 Y DDX39B n/a
5 TRCN0000074385 GAAGAAGAACTGCCCGCATAT pLKO.1 669 CDS 100% 10.800 5.400 Y DDX39B n/a
6 TRCN0000074386 GATAGACATCTCCTCCTACAT pLKO.1 1437 CDS 100% 4.950 2.475 Y DDX39B n/a
7 TRCN0000074387 TGCCGCAAGTTCATGCAAGAT pLKO.1 901 CDS 100% 4.950 2.475 Y DDX39B n/a
8 TRCN0000287043 TGCCGCAAGTTCATGCAAGAT pLKO_005 901 CDS 100% 4.950 2.475 Y DDX39B n/a
9 TRCN0000294383 TTTGGAATGTGACCGTCTGTC pLKO_005 1487 3UTR 100% 4.050 2.025 Y DDX39B n/a
10 TRCN0000074384 GCTATCACATTTGTGTCCGAT pLKO.1 1345 CDS 100% 2.640 1.320 Y DDX39B n/a
11 TRCN0000104083 CGCAAGTTCATGCAAGATCCT pLKO.1 904 CDS 100% 2.640 1.320 Y Ddx39b n/a
12 TRCN0000335759 CGCAAGTTCATGCAAGATCCT pLKO_005 904 CDS 100% 2.640 1.320 Y Ddx39b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004640.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07187 pDONR223 100% 99.9% 99.7% None 886T>C n/a
2 ccsbBroad304_07187 pLX_304 0% 99.9% 99.7% V5 886T>C n/a
3 TRCN0000471716 TTGTCGAATTCGCCTCTGGCGCAG pLX_317 31.2% 99.9% 99.7% V5 886T>C n/a
4 ccsbBroadEn_02356 pDONR223 100% 78.6% 89.9% None (many diffs) n/a
5 ccsbBroad304_02356 pLX_304 0% 78.6% 89.9% V5 (many diffs) n/a
6 TRCN0000470322 TTAATGTTGTCGGCCGCCTCAATT pLX_317 28.9% 78.6% 89.9% V5 (many diffs) n/a
Download CSV