Transcript: Human XM_011510698.2

PREDICTED: Homo sapiens septin 10 (SEPTIN10), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SEPTIN10 (151011)
Length:
3172
CDS:
258..1847

Additional Resources:

NCBI RefSeq record:
XM_011510698.2
NBCI Gene record:
SEPTIN10 (151011)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510698.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144316 CAAAGCAGATACGGTTTCTAA pLKO.1 836 CDS 100% 5.625 7.875 N SEPTIN10 n/a
2 TRCN0000142317 GCCTTATTATGGCTGACGTAT pLKO.1 2546 3UTR 100% 4.950 6.930 N SEPTIN10 n/a
3 TRCN0000140647 GCTGGTGAACAGATCCATTCA pLKO.1 377 CDS 100% 4.950 3.960 N SEPTIN10 n/a
4 TRCN0000141285 CCAAAGCAGATACGGTTTCTA pLKO.1 835 CDS 100% 5.625 3.938 N SEPTIN10 n/a
5 TRCN0000140716 GAAGGACAAGGACCGTAAGAA pLKO.1 1541 CDS 100% 5.625 3.938 N SEPTIN10 n/a
6 TRCN0000142403 GTCGGAAACAAGATGGTCAAA pLKO.1 1020 CDS 100% 4.950 3.465 N SEPTIN10 n/a
7 TRCN0000141151 CAAGAGACCTATGAAGCCAAA pLKO.1 1245 CDS 100% 4.050 2.835 N SEPTIN10 n/a
8 TRCN0000139056 CAGGCCAAATTTGAGCACCTT pLKO.1 1377 CDS 100% 2.640 1.848 N SEPTIN10 n/a
9 TRCN0000142614 GAACCTTGACAGCAAGGTAAA pLKO.1 797 CDS 100% 1.080 0.756 N SEPTIN10 n/a
10 TRCN0000139746 CCCAACGGATGATGACACTAT pLKO.1 929 CDS 100% 4.950 2.970 N SEPTIN10 n/a
11 TRCN0000141055 CATGAGTGAATTGGTCAGCAA pLKO.1 887 CDS 100% 2.640 1.584 N SEPTIN10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510698.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13268 pDONR223 100% 90.3% 89.5% None 0_1ins45;1452_1453insA;1476_1587del n/a
2 ccsbBroad304_13268 pLX_304 0% 90.3% 89.5% V5 0_1ins45;1452_1453insA;1476_1587del n/a
3 TRCN0000477479 GCGGCTGATGGCCGATATAAGTCT pLX_317 31.8% 90.3% 89.5% V5 0_1ins45;1452_1453insA;1476_1587del n/a
4 ccsbBroadEn_05045 pDONR223 100% 80.6% 79.7% None 0_1ins45;1305_1387del;1401_1587del n/a
5 ccsbBroad304_05045 pLX_304 0% 80.6% 79.7% V5 0_1ins45;1305_1387del;1401_1587del n/a
6 TRCN0000470390 ACGAGCTTACTATCCAGCAACTCG pLX_317 33.5% 80.6% 79.7% V5 0_1ins45;1305_1387del;1401_1587del n/a
Download CSV