Transcript: Human NM_001321511.2

Homo sapiens septin 10 (SEPTIN10), transcript variant 17, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
SEPTIN10 (151011)
Length:
4169
CDS:
140..922

Additional Resources:

NCBI RefSeq record:
NM_001321511.2
NBCI Gene record:
SEPTIN10 (151011)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321511.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144316 CAAAGCAGATACGGTTTCTAA pLKO.1 193 CDS 100% 5.625 7.875 N SEPTIN10 n/a
2 TRCN0000142317 GCCTTATTATGGCTGACGTAT pLKO.1 3545 3UTR 100% 4.950 6.930 N SEPTIN10 n/a
3 TRCN0000141285 CCAAAGCAGATACGGTTTCTA pLKO.1 192 CDS 100% 5.625 3.938 N SEPTIN10 n/a
4 TRCN0000140716 GAAGGACAAGGACCGTAAGAA pLKO.1 898 CDS 100% 5.625 3.938 N SEPTIN10 n/a
5 TRCN0000142403 GTCGGAAACAAGATGGTCAAA pLKO.1 377 CDS 100% 4.950 3.465 N SEPTIN10 n/a
6 TRCN0000141151 CAAGAGACCTATGAAGCCAAA pLKO.1 602 CDS 100% 4.050 2.835 N SEPTIN10 n/a
7 TRCN0000139056 CAGGCCAAATTTGAGCACCTT pLKO.1 734 CDS 100% 2.640 1.848 N SEPTIN10 n/a
8 TRCN0000139746 CCCAACGGATGATGACACTAT pLKO.1 286 CDS 100% 4.950 2.970 N SEPTIN10 n/a
9 TRCN0000141055 CATGAGTGAATTGGTCAGCAA pLKO.1 244 CDS 100% 2.640 1.584 N SEPTIN10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321511.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05045 pDONR223 100% 56.5% 54.8% None (many diffs) n/a
2 ccsbBroad304_05045 pLX_304 0% 56.5% 54.8% V5 (many diffs) n/a
3 TRCN0000470390 ACGAGCTTACTATCCAGCAACTCG pLX_317 33.5% 56.5% 54.8% V5 (many diffs) n/a
4 ccsbBroadEn_13268 pDONR223 100% 50.6% 49.3% None (many diffs) n/a
5 ccsbBroad304_13268 pLX_304 0% 50.6% 49.3% V5 (many diffs) n/a
6 TRCN0000477479 GCGGCTGATGGCCGATATAAGTCT pLX_317 31.8% 50.6% 49.3% V5 (many diffs) n/a
Download CSV