Transcript: Human NM_016475.5

Homo sapiens JNK1/MAPK8 associated membrane protein (JKAMP), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
JKAMP (51528)
Length:
2347
CDS:
74..1009

Additional Resources:

NCBI RefSeq record:
NM_016475.5
NBCI Gene record:
JKAMP (51528)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016475.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430403 TATTCGTTCATGTCGAGTATT pLKO_005 421 CDS 100% 13.200 18.480 N JKAMP n/a
2 TRCN0000130934 CCGAACCTTCAAGGATACTCT pLKO.1 966 CDS 100% 3.000 4.200 N JKAMP n/a
3 TRCN0000424863 CGCATTCTGCTTGGTATTAAT pLKO_005 556 CDS 100% 15.000 12.000 N JKAMP n/a
4 TRCN0000417215 CTCTGTTACACAGGGTAATAT pLKO_005 1200 3UTR 100% 15.000 10.500 N JKAMP n/a
5 TRCN0000129820 CACAGAATCTCCTGAACTTTA pLKO.1 220 CDS 100% 13.200 9.240 N JKAMP n/a
6 TRCN0000415903 GAACAAGATTGTCAGTATATC pLKO_005 1106 3UTR 100% 13.200 9.240 N JKAMP n/a
7 TRCN0000130000 GCACTTTACTTCTTCCCAATT pLKO.1 656 CDS 100% 10.800 7.560 N JKAMP n/a
8 TRCN0000174776 GAAATAGAGAACTGCTATGAT pLKO.1 782 CDS 100% 5.625 3.938 N Jkamp n/a
9 TRCN0000147960 GCAGCTATTATCACCTTACTT pLKO.1 374 CDS 100% 5.625 3.938 N JKAMP n/a
10 TRCN0000149715 GCTATGATCTTCTGGTCAGAA pLKO.1 795 CDS 100% 4.950 3.465 N JKAMP n/a
11 TRCN0000128348 CCTGTTGTGTTTCAGTTTGTT pLKO.1 1390 3UTR 100% 5.625 3.375 N JKAMP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016475.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08306 pDONR223 100% 99.8% 99.6% None 5C>G n/a
2 ccsbBroad304_08306 pLX_304 0% 99.8% 99.6% V5 5C>G n/a
3 TRCN0000470832 AGCGCTGGTGTAGAATCACCATTC pLX_317 48.6% 99.8% 99.6% V5 5C>G n/a
4 ccsbBroadEn_15847 pDONR223 0% 98% 97.7% None 4_21del n/a
5 ccsbBroad304_15847 pLX_304 0% 98% 97.7% V5 4_21del n/a
6 TRCN0000472160 CACAAGCCATCTCGATCTTTACTA pLX_317 54.8% 98% 97.7% V5 4_21del n/a
Download CSV