Transcript: Mouse NM_001205067.1

Mus musculus JNK1/MAPK8-associated membrane protein (Jkamp), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Jkamp (104771)
Length:
1958
CDS:
342..1259

Additional Resources:

NCBI RefSeq record:
NM_001205067.1
NBCI Gene record:
Jkamp (104771)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001205067.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000175511 CTTATATTACGCCTTCCCGTA pLKO.1 959 CDS 100% 2.160 3.024 N Jkamp n/a
2 TRCN0000264602 ACGCGTTCTGCTTGGTGTTAA pLKO_005 805 CDS 100% 13.200 10.560 N Jkamp n/a
3 TRCN0000264604 TCTGGTTACCCTGGCTGTATA pLKO_005 998 CDS 100% 13.200 10.560 N Jkamp n/a
4 TRCN0000216915 CTGTGGGAAGACCCTATTATT pLKO.1 362 CDS 100% 15.000 10.500 N Jkamp n/a
5 TRCN0000264600 CTGTGGGAAGACCCTATTATT pLKO_005 362 CDS 100% 15.000 10.500 N Jkamp n/a
6 TRCN0000264601 ATTACGCCTTCCCGTACATTA pLKO_005 964 CDS 100% 13.200 9.240 N Jkamp n/a
7 TRCN0000264603 TGGCTCTATCTGGGCTTTATG pLKO_005 495 CDS 100% 13.200 9.240 N Jkamp n/a
8 TRCN0000174776 GAAATAGAGAACTGCTATGAT pLKO.1 1032 CDS 100% 5.625 3.938 N Jkamp n/a
9 TRCN0000194371 CCTATGGCATAGTCTCCATCT pLKO.1 1108 CDS 100% 4.050 2.835 N Jkamp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001205067.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15847 pDONR223 0% 87.6% 98% None (many diffs) n/a
2 ccsbBroad304_15847 pLX_304 0% 87.6% 98% V5 (many diffs) n/a
3 TRCN0000472160 CACAAGCCATCTCGATCTTTACTA pLX_317 54.8% 87.6% 98% V5 (many diffs) n/a
4 ccsbBroadEn_08306 pDONR223 100% 85.9% 95.8% None (many diffs) n/a
5 ccsbBroad304_08306 pLX_304 0% 85.9% 95.8% V5 (many diffs) n/a
6 TRCN0000470832 AGCGCTGGTGTAGAATCACCATTC pLX_317 48.6% 85.9% 95.8% V5 (many diffs) n/a
Download CSV