Transcript: Human XM_006720171.4

PREDICTED: Homo sapiens JNK1/MAPK8 associated membrane protein (JKAMP), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
JKAMP (51528)
Length:
1719
CDS:
181..864

Additional Resources:

NCBI RefSeq record:
XM_006720171.4
NBCI Gene record:
JKAMP (51528)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006720171.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430403 TATTCGTTCATGTCGAGTATT pLKO_005 570 CDS 100% 13.200 18.480 N JKAMP n/a
2 TRCN0000130934 CCGAACCTTCAAGGATACTCT pLKO.1 1038 3UTR 100% 3.000 4.200 N JKAMP n/a
3 TRCN0000424863 CGCATTCTGCTTGGTATTAAT pLKO_005 705 CDS 100% 15.000 12.000 N JKAMP n/a
4 TRCN0000417215 CTCTGTTACACAGGGTAATAT pLKO_005 1272 3UTR 100% 15.000 10.500 N JKAMP n/a
5 TRCN0000129820 CACAGAATCTCCTGAACTTTA pLKO.1 369 CDS 100% 13.200 9.240 N JKAMP n/a
6 TRCN0000415903 GAACAAGATTGTCAGTATATC pLKO_005 1178 3UTR 100% 13.200 9.240 N JKAMP n/a
7 TRCN0000130000 GCACTTTACTTCTTCCCAATT pLKO.1 805 CDS 100% 10.800 7.560 N JKAMP n/a
8 TRCN0000147960 GCAGCTATTATCACCTTACTT pLKO.1 523 CDS 100% 5.625 3.938 N JKAMP n/a
9 TRCN0000149715 GCTATGATCTTCTGGTCAGAA pLKO.1 867 3UTR 100% 4.950 3.465 N JKAMP n/a
10 TRCN0000128348 CCTGTTGTGTTTCAGTTTGTT pLKO.1 1462 3UTR 100% 5.625 3.375 N JKAMP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006720171.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08306 pDONR223 100% 65.4% 64.9% None 1_33delinsA;38_47delTTTTGCTTAC;681_682ins294 n/a
2 ccsbBroad304_08306 pLX_304 0% 65.4% 64.9% V5 1_33delinsA;38_47delTTTTGCTTAC;681_682ins294 n/a
3 TRCN0000470832 AGCGCTGGTGTAGAATCACCATTC pLX_317 48.6% 65.4% 64.9% V5 1_33delinsA;38_47delTTTTGCTTAC;681_682ins294 n/a
4 ccsbBroadEn_15847 pDONR223 0% 63.3% 63.3% None 1_62del;63_64insTG;681_682ins294 n/a
5 ccsbBroad304_15847 pLX_304 0% 63.3% 63.3% V5 1_62del;63_64insTG;681_682ins294 n/a
6 TRCN0000472160 CACAAGCCATCTCGATCTTTACTA pLX_317 54.8% 63.3% 63.3% V5 1_62del;63_64insTG;681_682ins294 n/a
Download CSV