Construct: ORF TRCN0000470840
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018831.3_s317c1
- Derived from:
- ccsbBroadEn_15254
- DNA Barcode:
- GATCCCGGCAACAACTACTCGAAC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- NEK7 (140609)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470840
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 140609 | NEK7 | NIMA related kinase 7 | NM_133494.3 | 99.5% | 15.2% | 137_138insT;164T>N;206_207delATinsNN |
| 2 | human | 140609 | NEK7 | NIMA related kinase 7 | XM_017000344.1 | 96.9% | 14.8% | (many diffs) |
| 3 | human | 140609 | NEK7 | NIMA related kinase 7 | XM_017000345.1 | 96.9% | 14.8% | (many diffs) |
| 4 | human | 140609 | NEK7 | NIMA related kinase 7 | XM_017000346.1 | 84.7% | 16.9% | (many diffs) |
| 5 | human | 140609 | NEK7 | NIMA related kinase 7 | XM_017000347.1 | 67.3% | 20.3% | (many diffs) |
| 6 | human | 140609 | NEK7 | NIMA related kinase 7 | XM_017000348.1 | 67.3% | 20.3% | (many diffs) |
| 7 | human | 140609 | NEK7 | NIMA related kinase 7 | XM_011509209.1 | 52.5% | 28.7% | (many diffs) |
| 8 | mouse | 59125 | Nek7 | NIMA (never in mitosis gene... | NM_021605.4 | 90.8% | 14.9% | (many diffs) |
| 9 | mouse | 59125 | Nek7 | NIMA (never in mitosis gene... | NM_001311148.1 | 60.2% | 22.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 207
- ORF length:
- 138
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggatgagcaa tcacaaggaa tgcaagggcc acctgttcct cagttccaac 121 cacagaaggc cttacgaccg gatatgggct ataatacatt agccaacttt cgaatagaaa 181 agaaaattgg tcgcggacaa tttagttgaa gtttatagag cagcctgtct ctnggatgga 241 gtaccagtag ctttaaaaaa agtgcagata tttgnnttaa tggatgccaa agcacgtgct 301 gattgcatca aagaaataga tcttcttaag caactcaacc atccaaatgt aataaaatat 361 tatgcatcat tcattgaaga taatgaacta aacatagttt tggaactagc agatgctggc 421 gacctatcca gaatgatcaa gcattttaag aagcaaaaga ggctaattcc tgaaagaact 481 gtttggaagt attttgttca gctttgcagt gcattggaac acatgcattc tcgaagagtc 541 atgcatagag atataaaacc agctaatgtg ttcattacag ccactggggt ggtaaaactt 601 ggagatcttg ggcttggccg gtttttcagc tcaaaaacca cagctgcaca tTCTTTAGTT 661 GGTACGCCTT ATTACATGTC TCCAGAGAGA ATACATGAAA ATGGATACAA CTTCAAATCT 721 GACATCTGGT CTCTTGGCTG TCTACTATAT GAGATGGCTG CATTACAAAG TCCTTTCTAT 781 GGTGACAAAA TGAATTTATA CTCACTGTGT AAGAAGATAG AACAGTGTGA CTACCCACCT 841 CTTCCTTCAG ATCACTATTC AGAAGAACTC CGACAGTTAG TTAATATGTG CATCAACCCA 901 GATCCAGAGA AGCGACCAGA CGTCACCTAT GTTTATGACG TAGCAAAGAG GATGCATGCA 961 TGCACTGCAA GCAGCTTGCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC 1021 CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT 1081 ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG AGATCCCGGC AACAACTACT 1141 CGAACACGCG TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt