Construct: ORF TRCN0000471019
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007934.1_s317c1
- Derived from:
- ccsbBroadEn_07962
- DNA Barcode:
- ACATAGGAGTATCCCGAGGAAAGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CNOT10 (25904)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471019
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 25904 | CNOT10 | CCR4-NOT transcription comp... | NM_015442.3 | 99.9% | 100% | 1344G>T |
2 | human | 25904 | CNOT10 | CCR4-NOT transcription comp... | XM_017006109.2 | 99.8% | 99.8% | 1344G>T;1510_1511insGCA |
3 | human | 25904 | CNOT10 | CCR4-NOT transcription comp... | XM_017006110.2 | 98.3% | 98.2% | 1344G>T;1840_1841ins36 |
4 | human | 25904 | CNOT10 | CCR4-NOT transcription comp... | XM_017006111.2 | 98.2% | 98.1% | 1344G>T;1510_1511insGCA;1837_1838ins36 |
5 | human | 25904 | CNOT10 | CCR4-NOT transcription comp... | NM_001256741.2 | 96.3% | 96.2% | 1344G>T;1514_1515ins81 |
6 | human | 25904 | CNOT10 | CCR4-NOT transcription comp... | XM_017006112.2 | 94.7% | 94.4% | 1344G>T;1514_1515ins81;1759_1760ins36 |
7 | human | 25904 | CNOT10 | CCR4-NOT transcription comp... | NM_001256742.1 | 92% | 91.9% | (many diffs) |
8 | human | 25904 | CNOT10 | CCR4-NOT transcription comp... | XM_006713084.3 | 91.8% | 91.7% | (many diffs) |
9 | human | 25904 | CNOT10 | CCR4-NOT transcription comp... | XM_006713085.3 | 90.5% | 90.2% | (many diffs) |
10 | human | 25904 | CNOT10 | CCR4-NOT transcription comp... | XM_011533566.2 | 88.6% | 88.4% | (many diffs) |
11 | human | 25904 | CNOT10 | CCR4-NOT transcription comp... | XR_001740089.1 | 76.2% | (many diffs) | |
12 | human | 25904 | CNOT10 | CCR4-NOT transcription comp... | XM_011533567.2 | 69.3% | 69.3% | 0_1ins684;660G>T |
13 | human | 25904 | CNOT10 | CCR4-NOT transcription comp... | NR_046352.2 | 69% | (many diffs) | |
14 | mouse | 78893 | Cnot10 | CCR4-NOT transcription comp... | NM_153585.5 | 88.6% | 96.3% | (many diffs) |
15 | mouse | 78893 | Cnot10 | CCR4-NOT transcription comp... | XM_006512399.3 | 88.4% | 96.2% | (many diffs) |
16 | mouse | 78893 | Cnot10 | CCR4-NOT transcription comp... | XM_017313699.1 | 87% | 94.6% | (many diffs) |
17 | mouse | 78893 | Cnot10 | CCR4-NOT transcription comp... | XR_871264.2 | 73.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2298
- ORF length:
- 2232
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc tgcagacaag cctgcagatc agggagcaga gaaacatgaa ggcacaggtc 121 agtcctctgg gatcactgat caagagaagg agttatccac caatgctttc caagctttca 181 catctggaaa ttatgatgcc tgtctacaac accttgcctg tctacaagat ataaacaaag 241 atgattataa aataattttg aatacagcag tagctgagtt ttttaaaagt aaccaaacaa 301 caacagataa tttgagacaa acacttaacc agctgaagaa tcaggtccac tcagctgttg 361 aagaaatgga tggattagat gatgttgaaa acagcatgtt gtactataat caagcagtca 421 ttctttatca tctgcggcag tatacagaag ccatatcagt tggtgaaaaa ctttatcagt 481 tcatagagcc ttttgaagaa aaatttgccc aagcagtgtg ttttttgctt gtagacctgt 541 atatattaac ctaccaagct gagaaagctt tgcatcttct tgctgtccta gaaaaaatga 601 tttcacaggg taacaataac aaaaatggaa agaatgagac tggtaataac aacaacaaag 661 atggatctaa tcataaagct gaaagtggag ctctaataga agctgcaaaa tcaaagatac 721 atcagtacaa agtacgagct tatatccaaa tgaagtctct gaaagcatgt aaaagggaaa 781 tcaagtcagt catgaataca gctggaaatt ccgcaccctc tctctttctt aaaagcaatt 841 ttgagtactt aagaggtaat tatcgaaaag ccgtgaagct attaaatagt tcaaacattg 901 ctgagcatcc aggattcatg aaaacaggtg aatgcttgag atgcatgttc tggaataacc 961 ttggttgcat ccattttgcc atgagcaagc acaatttggg aatattctac tttaaaaagg 1021 ctctgcaaga gaatgacaat gtctgtgcac agctcagtgc aggtagcact gatccaggta 1081 aaaaattttc aggaagaccc atgtgtacgt tactaaccaa taagagatat gagttgctgt 1141 ataactgtgg aattcagctt cttcacattg gaaggcctct tgctgccttc gaatgtctga 1201 ttgaagctgt tcaggtttat catgcaaatc ctcgcctctg gctacggctg gctgaatgct 1261 gcattgctgc caataagggg acttctgaac aagaaactaa aggccttccc agcaaaaaag 1321 gaattgtaca gtctattgtt ggtcaaggct atcatcgtaa aatagttttg gcatcacagt 1381 ctatacagaa tactgtttat aatgatggtc agtcttcggc cattcctgta gccagtatgg 1441 agtttgcagc catatgtctc agaaatgcct tgttgctgct acctgaagaa cagcaagatc 1501 caaagcagga aaatggggct aaaaatagta atcaattagg tgggaacaca gagagcagcg 1561 aaagcagtga aacttgcagc agtaaaagcc atgatggaga taaattcatt ccagctccac 1621 cttcttctcc attgagaaaa caggaattag aaaacttaaa gtgctccata cttgcttgca 1681 gtgcctacgt ggctctggct ttgggtgata acctcatggc tttgaatcat gcagataaac 1741 ttcttcagca gcccaagctg tcaggatctc ttaagttttt gggacattta tatgctgcag 1801 aagccctcat ctctctcgac agaatatctg atgccattac tcacttgaac ccggagaatg 1861 tcactgatgt ctccttaggg atctcttcaa atgagcagga ccaaggatca gacaaaggtg 1921 aaaatgaagc aatggaatCC TCTGGTAAGC GGGCCCCTCA GTGCTACCCC AGTTCCGTCA 1981 ACTCTGCCAG GACTGTGATG CTGTTCAACC TTGGCAGCGC TTACTGCCTG AGGAGCGAAT 2041 ATGACAAAGC CCGAAAGTGT CTCCACCAGG CGGCTTCAAT GATCCATCCT AAAGAGGTGC 2101 CCCCTGAGGC CATCTTGCTG GCAGTCTACC TTGAACTGCA GAATGGTAAT ACTCAGCTGG 2161 CCTTACAGAT CATCAAAAGG AATCAGCTGC TCCCTGCAGT GAAAACACAC TCTGAAGTGA 2221 GAAAGAAGCC AGTGTTTCAG CCTGTCCACC CGATCCAGCC CATCCAAATG CCGGCTTTCA 2281 CCACTGTGCA GAGAAAGTGC CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 2341 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 2401 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGAACATAGG AGTATCCCGA 2461 GGAAAGAACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt