Transcript: Human XM_017021704.2

PREDICTED: Homo sapiens BRMS1 like transcriptional repressor (BRMS1L), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BRMS1L (84312)
Length:
2559
CDS:
246..1073

Additional Resources:

NCBI RefSeq record:
XM_017021704.2
NBCI Gene record:
BRMS1L (84312)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021704.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135586 GCTTTACATTTCACAGCTACA pLKO.1 1022 CDS 100% 4.050 5.670 N BRMS1L n/a
2 TRCN0000137579 CGATTAAGTCAGGTGGATGCA pLKO.1 348 CDS 100% 2.640 3.696 N BRMS1L n/a
3 TRCN0000135492 GTTACCAAATGTAAGTGCCAT pLKO.1 1111 3UTR 100% 2.640 2.112 N BRMS1L n/a
4 TRCN0000135563 GCTCTGCTTAGAATCTGTAAA pLKO.1 476 CDS 100% 13.200 9.240 N BRMS1L n/a
5 TRCN0000135533 CCGATCTCAAAGATCAACTTT pLKO.1 319 CDS 100% 5.625 3.938 N BRMS1L n/a
6 TRCN0000135639 GAGAAGATAAGAAGGCTTGAA pLKO.1 588 CDS 100% 4.950 3.465 N BRMS1L n/a
7 TRCN0000137248 GAGTGAACTAGAGGAGAAGAT pLKO.1 575 CDS 100% 4.950 3.465 N BRMS1L n/a
8 TRCN0000135719 GACAACAATTAGGAAGGCAAT pLKO.1 773 CDS 100% 4.050 2.835 N BRMS1L n/a
9 TRCN0000136822 CCAAATGTAAGTGCCATGAGA pLKO.1 1115 3UTR 100% 3.000 1.800 N BRMS1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021704.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04372 pDONR223 100% 85.1% 85.1% None 0_1ins144 n/a
2 ccsbBroad304_04372 pLX_304 0% 85.1% 85.1% V5 (not translated due to frame shift) 0_1ins144 n/a
3 TRCN0000471040 AAATGGCGGTGGGAAATTCTTAAG pLX_317 39% 85.1% 85.1% V5 (not translated due to frame shift) 0_1ins144 n/a
Download CSV