Transcript: Human XM_005268128.1

PREDICTED: Homo sapiens BRMS1 like transcriptional repressor (BRMS1L), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BRMS1L (84312)
Length:
2678
CDS:
200..1192

Additional Resources:

NCBI RefSeq record:
XM_005268128.1
NBCI Gene record:
BRMS1L (84312)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005268128.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137958 GACCAACCATCACGATGAGAT pLKO.1 232 CDS 100% 4.950 6.930 N BRMS1L n/a
2 TRCN0000135586 GCTTTACATTTCACAGCTACA pLKO.1 1141 CDS 100% 4.050 5.670 N BRMS1L n/a
3 TRCN0000137579 CGATTAAGTCAGGTGGATGCA pLKO.1 446 CDS 100% 2.640 3.696 N BRMS1L n/a
4 TRCN0000135492 GTTACCAAATGTAAGTGCCAT pLKO.1 1230 3UTR 100% 2.640 2.112 N BRMS1L n/a
5 TRCN0000135563 GCTCTGCTTAGAATCTGTAAA pLKO.1 574 CDS 100% 13.200 9.240 N BRMS1L n/a
6 TRCN0000135533 CCGATCTCAAAGATCAACTTT pLKO.1 417 CDS 100% 5.625 3.938 N BRMS1L n/a
7 TRCN0000135639 GAGAAGATAAGAAGGCTTGAA pLKO.1 686 CDS 100% 4.950 3.465 N BRMS1L n/a
8 TRCN0000137985 GAGGATGGAGATAGCTCAGAA pLKO.1 323 CDS 100% 4.950 3.465 N BRMS1L n/a
9 TRCN0000137248 GAGTGAACTAGAGGAGAAGAT pLKO.1 673 CDS 100% 4.950 3.465 N BRMS1L n/a
10 TRCN0000136070 GATAGCTCAGAAATGGATGAT pLKO.1 332 CDS 100% 4.950 3.465 N BRMS1L n/a
11 TRCN0000135719 GACAACAATTAGGAAGGCAAT pLKO.1 871 CDS 100% 4.050 2.835 N BRMS1L n/a
12 TRCN0000136822 CCAAATGTAAGTGCCATGAGA pLKO.1 1234 3UTR 100% 3.000 1.800 N BRMS1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005268128.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04372 pDONR223 100% 97.8% 97.5% None 728_748del n/a
2 ccsbBroad304_04372 pLX_304 0% 97.8% 97.5% V5 (not translated due to frame shift) 728_748del n/a
3 TRCN0000471040 AAATGGCGGTGGGAAATTCTTAAG pLX_317 39% 97.8% 97.5% V5 (not translated due to frame shift) 728_748del n/a
Download CSV