Transcript: Mouse NM_001311116.1

Mus musculus kelch repeat and BTB (POZ) domain containing 4 (Kbtbd4), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Kbtbd4 (67136)
Length:
2357
CDS:
55..1659

Additional Resources:

NCBI RefSeq record:
NM_001311116.1
NBCI Gene record:
Kbtbd4 (67136)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001311116.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112107 CCGATCCATGTTCACATCCAA pLKO.1 312 CDS 100% 3.000 4.200 N Kbtbd4 n/a
2 TRCN0000308918 CCGATCCATGTTCACATCCAA pLKO_005 312 CDS 100% 3.000 4.200 N Kbtbd4 n/a
3 TRCN0000112106 GCAGTTATCTACTATCGGGTA pLKO.1 1141 CDS 100% 2.160 3.024 N Kbtbd4 n/a
4 TRCN0000308919 GCAGTTATCTACTATCGGGTA pLKO_005 1141 CDS 100% 2.160 3.024 N Kbtbd4 n/a
5 TRCN0000112109 CCTGGGAAAGATGCCATATAT pLKO.1 1081 CDS 100% 15.000 10.500 N Kbtbd4 n/a
6 TRCN0000308917 CCTGGGAAAGATGCCATATAT pLKO_005 1081 CDS 100% 15.000 10.500 N Kbtbd4 n/a
7 TRCN0000112105 CCAGCAAGAATCAACTGTAAA pLKO.1 2094 3UTR 100% 13.200 9.240 N Kbtbd4 n/a
8 TRCN0000112108 GCTGCTTACCAACTTGCAGTT pLKO.1 1626 CDS 100% 4.050 2.835 N Kbtbd4 n/a
9 TRCN0000331894 GCTGCTTACCAACTTGCAGTT pLKO_005 1626 CDS 100% 4.050 2.835 N Kbtbd4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001311116.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03635 pDONR223 100% 89% 96.4% None (many diffs) n/a
2 ccsbBroad304_03635 pLX_304 0% 89% 96.4% V5 (many diffs) n/a
3 TRCN0000471095 GTCGCTACTGCAAACCAGACACGG pLX_317 30.4% 89% 96.4% V5 (many diffs) n/a
Download CSV