Construct: ORF TRCN0000471238
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013352.1_s317c1
- Derived from:
- ccsbBroadEn_02245
- DNA Barcode:
- CTGAAGCGTGGCCCAGTTTTCTCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- IST1 (9798)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471238
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9798 | IST1 | IST1 factor associated with... | NM_014761.4 | 100% | 100% | |
| 2 | human | 9798 | IST1 | IST1 factor associated with... | NM_001270975.2 | 98.3% | 79% | 853_856delGTAG;1085_1098del |
| 3 | human | 9798 | IST1 | IST1 factor associated with... | NM_001270976.1 | 94.9% | 76.4% | 1_39del;892_895delGTAG;1124_1137del |
| 4 | human | 9798 | IST1 | IST1 factor associated with... | NM_001270977.2 | 90.4% | 74.3% | 760_761delGTinsTC;763_764ins89;992_1005del |
| 5 | human | 9798 | IST1 | IST1 factor associated with... | NM_001270978.2 | 57.9% | 39.7% | 0_1ins444;409_412delGTAG;641_654del |
| 6 | human | 9798 | IST1 | IST1 factor associated with... | NM_001270979.1 | 57.9% | 39.7% | 0_1ins444;409_412delGTAG;641_654del |
| 7 | mouse | 71955 | Ist1 | increased sodium tolerance ... | NM_028018.2 | 87.4% | 76.7% | (many diffs) |
| 8 | mouse | 71955 | Ist1 | increased sodium tolerance ... | XM_017312970.1 | 84.7% | 76.4% | (many diffs) |
| 9 | mouse | 71955 | Ist1 | increased sodium tolerance ... | XM_017312971.1 | 70.7% | 58.5% | (many diffs) |
| 10 | mouse | 71955 | Ist1 | increased sodium tolerance ... | XR_001778470.1 | 38.8% | (many diffs) | |
| 11 | mouse | 71955 | Ist1 | increased sodium tolerance ... | XR_001778469.1 | 38.2% | (many diffs) | |
| 12 | mouse | 71955 | Ist1 | increased sodium tolerance ... | XR_001778468.1 | 35.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1146
- ORF length:
- 1080
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgct gggctctgga tttaaagctg agcgcttaag agtgaatttg agattagtca 121 taaatcgcct taaactattg gagaaaaaga aaacggaact ggcccagaaa gcaaggaagg 181 agattgctga ctatctggct gctgggaaag atgaacgagc tcggatccgt gtggagcaca 241 ttatccggga agactacctc gtggaggcca tggagatcct ggagctgtac tgtgacctgc 301 tgctggctcg gtttggcctt atccagtcta tgaaggaact agattctggt ctggctgaat 361 ctgtgtctac attgatctgg gctgctcctc gactccagtc agaagtggct gagttgaaaa 421 tagttgctga tcagctctgt gccaagtata gcaaggaata tggcaagcta tgtaggacca 481 accagattgg aactgtgaat gacaggctaa tgcacaagct gagtgtggaa gccccaccca 541 aaatcctggt ggagagatac ctgattgaaa ttgcaaagaa ttacaacgta ccctatgaac 601 ctgactctgt ggtcatggca gaagctcctc ctggggtaga gacagatctt attgatgttg 661 gattcacaga tgatgtgaag aaaggaggcc ctggaagagg agggagtggt ggcttcacag 721 caccagttgg tggaccTGAT GGAACGGTGC CAATGCCCAT GCCCATGCCC ATGCCTATGC 781 CATCTGCAAA TACGCCTTTC TCATATCCAC TGCCAAAGGG ACCATCAGAT TTCAATGGAC 841 TGCCAATGGG GACTTATCAG GCCTTTCCCA ATATTCATCC ACCTCAGATA CCAGCAACTC 901 CCCCATCGTA TGAATCTATG ACATTAATGC TGATAAGAAT ATCTCTTCTG CACAGATTGT 961 TGGTCCTGGA CCCAAGCCAG AAGCCTCTGC AAAGCTTCCT TCCAGACCTG CAGATAACTA 1021 TGACAACTTT GTCCTACCAG AGTTGCCATC TGTGCCAGAC ACACTACCAA CTGCATCTGC 1081 TGGTGCCAGC ACCTCAGCAT CTGAAGACAT TGACTTTGAT GATCTTTCCC GGAGGTTTGA 1141 AGAGCTGCCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1201 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1261 CTTGGCTTTA TATATCTTGT GGAAAGGACG ACTGAAGCGT GGCCCAGTTT TCTCTACGCG 1321 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt