Construct: ORF TRCN0000471312
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008624.1_s317c1
- Derived from:
- ccsbBroadEn_12514
- DNA Barcode:
- AAGGGTACCAATCTTAAGTGACCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MPPE1 (65258)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471312
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 65258 | MPPE1 | metallophosphoesterase 1 | NM_001242904.2 | 100% | 100% | |
2 | human | 65258 | MPPE1 | metallophosphoesterase 1 | NM_001319154.2 | 100% | 100% | |
3 | human | 65258 | MPPE1 | metallophosphoesterase 1 | NM_001330563.2 | 89% | 89% | 677_799del |
4 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_017025927.2 | 89% | 89% | 677_799del |
5 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_017025928.1 | 89% | 89% | 677_799del |
6 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_017025929.2 | 89% | 89% | 677_799del |
7 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_011525734.2 | 85.8% | 85.8% | 677_678ins141 |
8 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_024451237.1 | 85.8% | 85.8% | 677_678ins141 |
9 | human | 65258 | MPPE1 | metallophosphoesterase 1 | NM_023075.6 | 84% | 84% | 677_865del |
10 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_006722346.3 | 84% | 84% | 677_865del |
11 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_017025922.2 | 84% | 84% | 677_865del |
12 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_017025923.2 | 84% | 84% | 677_865del |
13 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_017025924.2 | 84% | 84% | 677_865del |
14 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_017025925.1 | 84% | 84% | 677_865del |
15 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_017025926.2 | 84% | 84% | 677_865del |
16 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_006722340.3 | 83.8% | 83.8% | 677_868del |
17 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_006722341.4 | 83.8% | 83.8% | 677_868del |
18 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_006722342.4 | 83.8% | 83.8% | 677_868del |
19 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_006722343.3 | 83.8% | 83.8% | 677_868del |
20 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_006722345.4 | 83.8% | 83.8% | 677_868del |
21 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_011525731.3 | 83.8% | 83.8% | 677_868del |
22 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_017025920.2 | 83.8% | 83.8% | 677_868del |
23 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_017025931.1 | 79.3% | 68.7% | (many diffs) |
24 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_006722348.2 | 77.9% | 65.7% | (many diffs) |
25 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_017025930.2 | 69.8% | 69.1% | (many diffs) |
26 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XM_011525732.2 | 69.6% | 69% | (many diffs) |
27 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XR_935068.3 | 56.8% | 1_346del;1023_1307del;1557_1558ins73 | |
28 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XR_001753265.2 | 56.1% | 1_242del;919_1203del;1527_1780del | |
29 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XR_002958184.1 | 51.9% | (many diffs) | |
30 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XR_002958183.1 | 51.8% | (many diffs) | |
31 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XR_001753263.2 | 50% | (many diffs) | |
32 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XR_001753264.2 | 49.2% | (many diffs) | |
33 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XR_001753261.1 | 37.9% | (many diffs) | |
34 | human | 65258 | MPPE1 | metallophosphoesterase 1 | XR_001753262.2 | 34.4% | (many diffs) | |
35 | human | 65258 | MPPE1 | metallophosphoesterase 1 | NR_040241.2 | 28.5% | (many diffs) | |
36 | human | 65258 | MPPE1 | metallophosphoesterase 1 | NR_040243.2 | 28.5% | (many diffs) | |
37 | human | 65258 | MPPE1 | metallophosphoesterase 1 | NR_040242.4 | 27.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1065
- ORF length:
- 999
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gatgatcgaa ttggggtttg gaagacagaa ttttcatcca ttaaagagga 121 agagttcatt gctgttgaaa ctcatagctg ttgtctttgc tgtgcttcta ttttgtgaat 181 ttttaatcta ttacttagcg atctttcagt gtaattggcc tgaagtgaaa accacagcct 241 ctgatggtga acagaccaca cgtgagcctg tgctcaaagc catgtttttg gctgacaccc 301 atttgcttgg ggaattccta ggccactggc tggacaaatt acgaagggaa tggcagatgg 361 agagagcgtt ccagacagct ctgtggttgc tgcagccgga agtcgtcttc atcctggggg 421 atatctttga tgaagggaag tggagcaccc ctgaggcctg ggcggatgat gtggagcggt 481 ttcagaaaat gttcagacac ccaagtcatg tacagctgaa ggtagttgct ggaaaccatg 541 acattggctt ccattatgag atgaacacat acaaagtaga acgctttgag aaagtgttca 601 gctctgaaag actgttttct tggaaaggca ttaactttgt gatggtcaac agcgtggcgc 661 tgaacgggga tggctgtggc atctgctcTG AAACAGAAGC AGAGCTCATT GAAGTTTCTC 721 ACAGACTGAA CTGCTCCCGA GAGCTGCTGT GGTGGCTCCA GCCGCGCCTG GTTCTCAGTG 781 GCCACACGCA CAGCGCCTGC GAGGTGCACC ACGGGGGCCG AGTCCCCGAG CTCAGCGTCC 841 CATCTTTCAG TTGGAGGAAC AGAAACAACC CCAGTTTCAT CATGGGTAGC ATCACGCCCA 901 CAGACTACAC CCTCTCCAAG TGCTACCTCC CACGTGAGGA TGTGGTTTTG ATCATCTACT 961 GTGGAGTGGT GGGCTTCCTT GTGGTCCTCA CACTCACTCA CTTTGGGCTT CTAGCCTCAC 1021 CTTTTCTTTC TGGTTTGAAC TTGCTCGGAA AGCGTAAGAC AAGATGCCCA ACTTTCTTGT 1081 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1141 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1201 GAAAGGACGA AAGGGTACCA ATCTTAAGTG ACCAACGCGT TAAGTCgaca atcaacctct 1261 ggattacaaa atttgtgaaa gatt