Transcript: Human XM_017021363.2

PREDICTED: Homo sapiens Enah/Vasp-like (EVL), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EVL (51466)
Length:
4215
CDS:
695..1984

Additional Resources:

NCBI RefSeq record:
XM_017021363.2
NBCI Gene record:
EVL (51466)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021363.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063871 CGGCTTAAACTTTGCAAGTAA pLKO.1 976 CDS 100% 5.625 7.875 N EVL n/a
2 TRCN0000286943 CGGCTTAAACTTTGCAAGTAA pLKO_005 976 CDS 100% 5.625 7.875 N EVL n/a
3 TRCN0000063872 TGTCCTCGATTCTGTCCAGAA pLKO.1 1832 CDS 100% 4.050 5.670 N EVL n/a
4 TRCN0000286941 TGTCCTCGATTCTGTCCAGAA pLKO_005 1832 CDS 100% 4.050 5.670 N EVL n/a
5 TRCN0000294336 ACGATGACACCAGTAAGAAAT pLKO_005 759 CDS 100% 13.200 9.240 N EVL n/a
6 TRCN0000063870 CCGGATCAACATCTACCACAA pLKO.1 814 CDS 100% 4.050 2.835 N EVL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021363.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03311 pDONR223 100% 79.6% 65.4% None (many diffs) n/a
2 ccsbBroad304_03311 pLX_304 0% 79.6% 65.4% V5 (many diffs) n/a
3 ccsbBroadEn_10459 pDONR223 100% 79.3% 65.4% None (many diffs) n/a
4 ccsbBroad304_10459 pLX_304 0% 79.3% 65.4% V5 (many diffs) n/a
5 TRCN0000471524 TTTACTACCAGAGTAGATCTTTTT pLX_317 17.9% 79.3% 65.4% V5 (many diffs) n/a
Download CSV