Construct: ORF TRCN0000471746
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001205.1_s317c1
- Derived from:
- ccsbBroadEn_12810
- DNA Barcode:
- TTGAATTCCGTTTATATTACAGAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SARNP (84324)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471746
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 84324 | SARNP | SAP domain containing ribon... | NM_033082.4 | 51.8% | 51.1% | (many diffs) |
| 2 | human | 84324 | SARNP | SAP domain containing ribon... | NR_026723.1 | 37.8% | (many diffs) | |
| 3 | human | 84324 | SARNP | SAP domain containing ribon... | NR_026722.1 | 35% | (many diffs) | |
| 4 | human | 85406 | DNAJC14 | DnaJ heat shock protein fam... | NM_032364.5 | 21.5% | 21.5% | (many diffs) |
| 5 | mouse | 66118 | Sarnp | SAP domain containing ribon... | NM_025364.2 | 47.9% | 49.1% | (many diffs) |
| 6 | mouse | 66118 | Sarnp | SAP domain containing ribon... | XM_006513949.3 | 47.7% | 48.8% | (many diffs) |
| 7 | mouse | 66118 | Sarnp | SAP domain containing ribon... | XM_006513950.3 | 42.5% | 43.1% | (many diffs) |
| 8 | mouse | 66118 | Sarnp | SAP domain containing ribon... | XM_006513951.3 | 42.4% | 42.9% | (many diffs) |
| 9 | mouse | 66118 | Sarnp | SAP domain containing ribon... | XM_011243523.2 | 29% | 31.3% | (many diffs) |
| 10 | mouse | 66118 | Sarnp | SAP domain containing ribon... | XM_011243524.2 | 29% | 31.3% | (many diffs) |
| 11 | mouse | 74330 | Dnajc14 | DnaJ heat shock protein fam... | NM_028873.4 | 19.6% | 19.9% | (many diffs) |
| 12 | mouse | 74330 | Dnajc14 | DnaJ heat shock protein fam... | XM_006514249.3 | 19.6% | 19.9% | (many diffs) |
| 13 | mouse | 74330 | Dnajc14 | DnaJ heat shock protein fam... | XM_006514250.2 | 19.6% | 19.9% | (many diffs) |
| 14 | mouse | 74330 | Dnajc14 | DnaJ heat shock protein fam... | XM_006514251.1 | 19.6% | 19.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1233
- ORF length:
- 1167
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa acgaatggca gagaatgagc tgagccggtc agtaaatgag tttctgtcca 121 agctgcaaga tgacctcaag gaggcaatga atactatgat gtgtagccga tgccaaggaa 181 agcataggag gtttgaaatg gaccgggaac ctaagagtgc cagatactgt gctgagtgta 241 ataggctgca tcctgctgag gaaggagact tttgggcaga gtcaagcatg ttgggcctca 301 agatcaccta ctttgcactg atggatggaa aggtgtatga catcacagag tgggctggat 361 gccagcgtgt aggtatctcc ccagataccc acagagtccc ctatcacatc tcatttggtt 421 ctcggattcc aggcaccaga gggcggcaga gagccacccc agatgcccct cctgctgatc 481 ttcaggattt cttgagtcgg atctttcaag tacccccagg gcagatgccc aatgggaact 541 tctttgcagc tcctcagcct gcccctggag ccgctgcagc ctctaagccc aacagcacag 601 tacccaaggg agaagccaaa cctaagcggc ggaagaaact tgccgaacta aagcaagaat 661 gtcttgctcg tggtttggag accaagggaa taaagcaaga tcttatccac agactccagg 721 catatcttga agaacatgct gaagaggagg caaatgaaga agatgtactg GGAGATGAAA 781 CAGAGGAAGA AGAAACAAAG CCCATTGAGC TCCCTGTCAA AGAGGAAGAA CCCCCTGAAA 841 AAACTGTTGA TGTGGCAGCA GAGAAGAAAG TGGTGAAAAT TACATCTGAA ATACCACAGA 901 CTGAGAGAAT GCAGAAGAGG GCTGAACGAT TCAATGTACC TGTGAGCTTG GAGAGTAAGA 961 AAGTTGCTCG GGCAGCTAGG TTTGGGATTT CTTCAGTTCC AACAAAAGGT CTGTCATCTG 1021 ATAACAAACC TATGGTTAAC TTGGATAAGC TGAAGGAAAG AGCTCAAAGA TTTGGTTTGA 1081 ATGTCTCTTC AATCTCCAGA AAGTCTGAAG ATGATGAGAA ACTGAAAAAG AGGAAGGAGC 1141 GATTTGGGAT TGTCACAAGT TCAGCTGGAA CTGGAACCAC AGAGGATACA GAGGCAAAGA 1201 AGAGGAAAAG AGCAGAGCGC TTTGGGATTG CCTGCCCAAC TTTCTTGTAC AAAGTGGTTG 1261 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 1321 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGATT 1381 GAATTCCGTT TATATTACAG ATACGCGTTA AGTCgacaat caacctctgg attacaaaat 1441 ttgtgaaaga tt