Transcript: Mouse XM_006513950.3

PREDICTED: Mus musculus SAP domain containing ribonucleoprotein (Sarnp), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sarnp (66118)
Length:
990
CDS:
172..735

Additional Resources:

NCBI RefSeq record:
XM_006513950.3
NBCI Gene record:
Sarnp (66118)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513950.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239934 GCCCATAGAACTGCCTGTTAA pLKO_005 369 CDS 100% 13.200 18.480 N Gm6563 n/a
2 TRCN0000239933 AGAGGGCTGAACGATTCAATG pLKO_005 485 CDS 100% 10.800 15.120 N Gm6563 n/a
3 TRCN0000436379 AGAATGTCTTGCTCGTGGTTT pLKO_005 225 CDS 100% 4.950 6.930 N SARNP n/a
4 TRCN0000120007 CCTATCTACATACACAGTCAT pLKO.1 825 3UTR 100% 4.950 6.930 N Sarnp n/a
5 TRCN0000345387 CCTATCTACATACACAGTCAT pLKO_005 825 3UTR 100% 4.950 6.930 N Sarnp n/a
6 TRCN0000120011 GCTGAACGATTCAATGTACCT pLKO.1 490 CDS 100% 2.640 3.696 N Sarnp n/a
7 TRCN0000152985 GCTGAACGATTCAATGTACCT pLKO.1 490 CDS 100% 2.640 3.696 N SARNP n/a
8 TRCN0000345385 GCTGAACGATTCAATGTACCT pLKO_005 490 CDS 100% 2.640 3.696 N Sarnp n/a
9 TRCN0000120010 GCTGTTGATATGGCATCGGAA pLKO.1 412 CDS 100% 2.640 3.696 N Sarnp n/a
10 TRCN0000239931 TTTAGAGACCAAGGGAATAAA pLKO_005 243 CDS 100% 15.000 10.500 N Gm6563 n/a
11 TRCN0000120009 CCCATAGAACTGCCTGTTAAA pLKO.1 370 CDS 100% 13.200 9.240 N Sarnp n/a
12 TRCN0000345384 CCCATAGAACTGCCTGTTAAA pLKO_005 370 CDS 100% 13.200 9.240 N Sarnp n/a
13 TRCN0000152507 GAAGATGTACTGGGAGATGAA pLKO.1 328 CDS 100% 4.950 2.970 N SARNP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513950.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04377 pDONR223 100% 79.6% 84.7% None (many diffs) n/a
2 ccsbBroad304_04377 pLX_304 0% 79.6% 84.7% V5 (many diffs) n/a
3 TRCN0000471172 TTGGGTTGGATTCACCACCTGCCA pLX_317 72.7% 79.6% 84.7% V5 (many diffs) n/a
4 ccsbBroadEn_12810 pDONR223 100% 42.5% 43.1% None (many diffs) n/a
5 ccsbBroad304_12810 pLX_304 0% 42.5% 43.1% V5 (many diffs) n/a
6 TRCN0000471746 TTGAATTCCGTTTATATTACAGAT pLX_317 39.8% 42.5% 43.1% V5 (many diffs) n/a
Download CSV