Construct: ORF TRCN0000472166
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006383.1_s317c1
- Derived from:
- ccsbBroadEn_07961
- DNA Barcode:
- ATTAGGATACGCCAGGGCAGTGCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RCHY1 (25898)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472166
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 25898 | RCHY1 | ring finger and CHY zinc fi... | NM_015436.3 | 99.8% | 99.6% | 425G>A |
| 2 | human | 25898 | RCHY1 | ring finger and CHY zinc fi... | NM_001009922.2 | 96.4% | 96.1% | 425G>A;509_510ins27 |
| 3 | human | 25898 | RCHY1 | ring finger and CHY zinc fi... | NM_001278538.1 | 91.4% | 88.8% | 0_1ins22;22_23ins44;359G>A |
| 4 | human | 25898 | RCHY1 | ring finger and CHY zinc fi... | NM_001278536.1 | 84.5% | 84.2% | 90_91ins120;305G>A |
| 5 | human | 25898 | RCHY1 | ring finger and CHY zinc fi... | NM_001278537.1 | 81% | 80.8% | 90_91ins120;305G>A;389_390ins27 |
| 6 | human | 25898 | RCHY1 | ring finger and CHY zinc fi... | NM_001278539.1 | 51.2% | 50.9% | 0_1ins381;44G>A |
| 7 | human | 25898 | RCHY1 | ring finger and CHY zinc fi... | XM_011531838.2 | 51.2% | 50.9% | 0_1ins381;44G>A |
| 8 | human | 25898 | RCHY1 | ring finger and CHY zinc fi... | XM_011531839.2 | 51.2% | 50.9% | 0_1ins381;44G>A |
| 9 | human | 25898 | RCHY1 | ring finger and CHY zinc fi... | XM_024453984.1 | 47.7% | 47.5% | 0_1ins381;44G>A;128_129ins27 |
| 10 | human | 25898 | RCHY1 | ring finger and CHY zinc fi... | NR_103723.1 | 17.6% | (many diffs) | |
| 11 | human | 25898 | RCHY1 | ring finger and CHY zinc fi... | NR_037913.1 | 17.4% | (many diffs) | |
| 12 | human | 25898 | RCHY1 | ring finger and CHY zinc fi... | NR_037914.1 | 17.3% | (many diffs) | |
| 13 | human | 25898 | RCHY1 | ring finger and CHY zinc fi... | NR_103724.1 | 16.7% | (many diffs) | |
| 14 | human | 25898 | RCHY1 | ring finger and CHY zinc fi... | NR_103725.1 | 15.5% | (many diffs) | |
| 15 | mouse | 68098 | Rchy1 | ring finger and CHY zinc fi... | NM_026557.4 | 87.8% | 90% | (many diffs) |
| 16 | mouse | 68098 | Rchy1 | ring finger and CHY zinc fi... | NM_001271797.1 | 74.2% | 75.4% | (many diffs) |
| 17 | mouse | 68098 | Rchy1 | ring finger and CHY zinc fi... | XM_006535191.3 | 59.2% | 50.1% | (many diffs) |
| 18 | mouse | 68098 | Rchy1 | ring finger and CHY zinc fi... | NR_073442.1 | 33% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 849
- ORF length:
- 783
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggcgacggcc cgggaagatg gcgccagcgg tcaagagcga ggtcagcggg 121 gctgcgagca ctatgacaga ggatgtctcc taaaggcacc ttgctgtgac aagctttata 181 cttgccgctt gtgtcatgat aacaatgaag atcatcaact agatcgcttt aaagtgaagg 241 aagtgcagtg cataaactgt gaaaaaattc aacatgccca acagacttgt gaagaatgta 301 gcacattgtt tggagaatat tattgcgata tatgccattt gtttgacaaa gataagaagc 361 agtatcactg tgaaaactgt ggaatttgta ggattggtcc aaaggaagat tttttccatt 421 gtttgaaatg taacttatgc ctagctatga aTCTTCAAGG AAGACACAAG TGTATTGAAA 481 ATGTGTCCCA ACAGAATTGT CCAATATGTT TGGAGGACAT TCACACATCC CGTGTTGTTG 541 CTCATGTCTT GCCATGTGGA CATCTTTTAC ATAGAACGTG TTATGAAGAA ATGTTGAAAG 601 AAGGCTACAG ATGTCCATTA TGTATGCACT CTGCTTTAGA TATGACCAGG TATTGGAGAC 661 AGCTGGATGA TGAAGTAGCA CAGACTCCTA TGCCATCAGA ATATCAGAAC ATGACTGTGG 721 ATATTCTCTG CAATGACTGT AATGGACGAT CCACTGTTCA GTTTCATATA TTAGGCATGA 781 AATGTAAGAT TTGTGAATCC TATAATACTG CTCAAGCTGG AGGACGTAGA ATTTCACTGG 841 ATCAGCAATG CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 901 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 961 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAATTAGG ATACGCCAGG GCAGTGCGAC 1021 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt