Transcript: Mouse XM_006535191.3

PREDICTED: Mus musculus ring finger and CHY zinc finger domain containing 1 (Rchy1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rchy1 (68098)
Length:
1886
CDS:
527..1054

Additional Resources:

NCBI RefSeq record:
XM_006535191.3
NBCI Gene record:
Rchy1 (68098)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535191.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217325 GGTGATTGTAATAGCGATTAC pLKO.1 1229 3UTR 100% 1.080 1.512 N Rchy1 n/a
2 TRCN0000241092 TAGTCACATTCATCGAAATAT pLKO_005 1330 3UTR 100% 15.000 10.500 N Rchy1 n/a
3 TRCN0000241093 CCGGCAGAATTGTCCAATATG pLKO_005 691 CDS 100% 13.200 9.240 N Rchy1 n/a
4 TRCN0000241090 CTCCTACATAGAACGTGTTAT pLKO_005 767 CDS 100% 13.200 9.240 N Rchy1 n/a
5 TRCN0000241091 ACTCCCATGCCATCCGAATAC pLKO_005 887 CDS 100% 10.800 7.560 N Rchy1 n/a
6 TRCN0000194505 GAATACCAGAACGTGACTGTT pLKO.1 902 CDS 100% 4.950 3.465 N Rchy1 n/a
7 TRCN0000004091 GCAATGACTGTAATGGACGAT pLKO.1 933 CDS 100% 2.640 1.848 N RCHY1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535191.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07961 pDONR223 100% 59.2% 50.1% None (many diffs) n/a
2 ccsbBroad304_07961 pLX_304 0% 59.2% 50.1% V5 (many diffs) n/a
3 TRCN0000472166 ATTAGGATACGCCAGGGCAGTGCG pLX_317 50.8% 59.2% 50.1% V5 (many diffs) n/a
4 ccsbBroadEn_11779 pDONR223 100% 28.7% 20.6% None (many diffs) n/a
5 ccsbBroad304_11779 pLX_304 0% 28.7% 20.6% V5 (many diffs) n/a
6 TRCN0000476628 GCTTGACAAACGTCGGGACCACTT pLX_317 82.2% 28.7% 20.6% V5 (many diffs) n/a
Download CSV