Transcript: Mouse NR_073442.1

Mus musculus ring finger and CHY zinc finger domain containing 1 (Rchy1), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Rchy1 (68098)
Length:
2021
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_073442.1
NBCI Gene record:
Rchy1 (68098)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_073442.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217325 GGTGATTGTAATAGCGATTAC pLKO.1 1302 3UTR 100% 1.080 1.512 N Rchy1 n/a
2 TRCN0000241092 TAGTCACATTCATCGAAATAT pLKO_005 1403 3UTR 100% 15.000 10.500 N Rchy1 n/a
3 TRCN0000241093 CCGGCAGAATTGTCCAATATG pLKO_005 764 3UTR 100% 13.200 9.240 N Rchy1 n/a
4 TRCN0000241090 CTCCTACATAGAACGTGTTAT pLKO_005 840 3UTR 100% 13.200 9.240 N Rchy1 n/a
5 TRCN0000241091 ACTCCCATGCCATCCGAATAC pLKO_005 960 3UTR 100% 10.800 7.560 N Rchy1 n/a
6 TRCN0000194505 GAATACCAGAACGTGACTGTT pLKO.1 975 3UTR 100% 4.950 3.465 N Rchy1 n/a
7 TRCN0000004091 GCAATGACTGTAATGGACGAT pLKO.1 1006 3UTR 100% 2.640 1.848 N RCHY1 n/a
8 TRCN0000215631 GAGAATATTACTGCAGTATTT pLKO.1 589 3UTR 100% 13.200 7.920 N Rchy1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_073442.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07961 pDONR223 100% 33% None (many diffs) n/a
2 ccsbBroad304_07961 pLX_304 0% 33% V5 (many diffs) n/a
3 TRCN0000472166 ATTAGGATACGCCAGGGCAGTGCG pLX_317 50.8% 33% V5 (many diffs) n/a
Download CSV