Construct: ORF TRCN0000472205
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016172.1_s317c1
- Derived from:
- ccsbBroadEn_01286
- DNA Barcode:
- CCCGGTACAACTATCCGTGCCAGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MAPK4 (5596)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472205
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 5596 | MAPK4 | mitogen-activated protein k... | NM_002747.4 | 100% | 100% | |
2 | human | 5596 | MAPK4 | mitogen-activated protein k... | XM_005258299.3 | 100% | 100% | |
3 | human | 5596 | MAPK4 | mitogen-activated protein k... | XM_011526074.2 | 100% | 100% | |
4 | human | 5596 | MAPK4 | mitogen-activated protein k... | XM_011526075.3 | 100% | 100% | |
5 | human | 5596 | MAPK4 | mitogen-activated protein k... | XM_011526076.2 | 100% | 100% | |
6 | human | 5596 | MAPK4 | mitogen-activated protein k... | XM_017025839.2 | 100% | 100% | |
7 | human | 5596 | MAPK4 | mitogen-activated protein k... | XM_011526077.2 | 69.7% | 68.9% | (many diffs) |
8 | human | 5596 | MAPK4 | mitogen-activated protein k... | NM_001292039.2 | 64% | 64% | 0_1ins633 |
9 | human | 5596 | MAPK4 | mitogen-activated protein k... | XM_011526078.2 | 56.1% | 51.2% | (many diffs) |
10 | human | 5596 | MAPK4 | mitogen-activated protein k... | NM_001292040.2 | 39.5% | 39.3% | 693_694delTAinsGG;697_698insA;699_700ins1061 |
11 | mouse | 225724 | Mapk4 | mitogen-activated protein k... | NM_172632.2 | 87.1% | 93.5% | (many diffs) |
12 | mouse | 225724 | Mapk4 | mitogen-activated protein k... | XM_006525900.3 | 87.1% | 93.5% | (many diffs) |
13 | mouse | 225724 | Mapk4 | mitogen-activated protein k... | XM_006525901.3 | 87.1% | 93.5% | (many diffs) |
14 | mouse | 225724 | Mapk4 | mitogen-activated protein k... | XM_017317891.1 | 59.9% | 63.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1830
- ORF length:
- 1761
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggctgagaag ggtgactgca tcgccagtgt ctatgggtat gacctcggtg 121 ggcgctttgt tgacttccaa cccctgggct tcggtgtcaa tggtttggtg ctgtcggccg 181 tggacagccg ggcctgccgg aaggtcgctg tgaagaagat tgccctgagc gatgcccgca 241 gcatgaagca cgcgctccga gagatcaaga tcattcggcg cctggaccac gacaacatcg 301 tcaaagtgta cgaggtgctc ggtcccaagg gcactgacct gcagggtgag ctgttcaagt 361 tcagcgtggc gtacatcgtc caggagtaca tggagaccga cctggcacgc ctgctggagc 421 agggcacgct ggcagaagag catgccaagc tgttcatgta ccagctgctc cgcgggctca 481 agtacatcca ctccgccaac gtgctgcaca gggacctgaa gcccgccaac atcttcatca 541 gcacagagga cctcgtgctc aagattgggg atttcgggtt ggcaaggatc gttgatcagc 601 attactccca caagggttat ctgtcagaag ggttggtaac aaagtggtac cgttccccac 661 gactgctcct ttcccccaat aactacacca aagccatcga catgtgggcc gccggctgca 721 tcctggctga gatgcttacg gggagaatgc tctttgctgg ggcccatgag ctggagcaga 781 tgcaactcat cctggagacc atccctgtaa tccgggagga agacaaggac gagctgctca 841 gggtgatgcc ttcctttgtc agcagcacct gggaggtgaa gaggcctctg cgcaagctgc 901 tccctgaagt gaacagtgaa gccatcgact ttctggagaa gatcctgacc tttaacccca 961 tggatcgcct aacagctgag atggggctgc aacaccccta catgagccca tactcgtgcc 1021 ctgaggacga gcccacctca caacacccct tccgcattga ggatgagatc gacgacatcg 1081 tgctgatggc cgctaaccag agccagctgt ccaactggga cacgtgcagt tccaggtacc 1141 ctgtgagcct gtcgtcggac ctggagtggc ggcctgaccg gtgccaggac gccagcgagg 1201 tacagcgcga cccgcgcgcg ggttcggcgc cactggctga ggacgtgcag gtggacccgc 1261 gcaaggactc gcacagcagc tccgagcgct tcctagagca gtcgcactcg tccatggagc 1321 gcgccttcga ggccgactac gggcgctcct gcgactacaa ggtggggtcg ccgtcctacc 1381 tggacaagct gctgtggcgc gacaacaagc cgcaccacta ctcggagccc aagctcaTCC 1441 TGGACCTGTC GCACTGGAAG CAGGCGGCCG GCGCGCCCCC CACGGCCACG GGGCTGGCGG 1501 ACACGGGGGC GCGCGAGGAC GAGCCGGCCA GCCTCTTCCT GGAGATCGCG CAGTGGGTCA 1561 AGAGCACGCA GGGCGGCCCA GAGCACGCCA GCCCGCCCGC CGACGACCCC GAGCGCCGCT 1621 TGTCTGCCTC GCCCCCCGGC CGCCCGGCCC CGGTGGACGG CGGCGCCAGC CCCCAGTTCG 1681 ACCTGGACGT GTTCATCTCC CGCGCCCTGA AGCTCTGCAC CAAGCCCGAG GACCTGCCGG 1741 ACAATAAACT GGGCGACCTC AATGGTGCGT GCATCCCCGA GCACCCTGGC GACCTCGTGC 1801 AGACCGAGGC CTTCTCCAAA GAAAGGTGGT TGCCAACTTT CTTGTACAAA GTGGTTGATA 1861 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1921 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGACCCGG 1981 TACAACTATC CGTGCCAGAA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 2041 tgaaagatt