Transcript: Human XM_011526075.3

PREDICTED: Homo sapiens mitogen-activated protein kinase 4 (MAPK4), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAPK4 (5596)
Length:
4792
CDS:
1057..2820

Additional Resources:

NCBI RefSeq record:
XM_011526075.3
NBCI Gene record:
MAPK4 (5596)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147141 TGATCAGCATTACTCCCACA pXPR_003 AGG 541 31% 2 1.0668 MAPK4 MAPK4 77223
2 BRDN0001148116 CAGCTGTTAGGCGATCCATG pXPR_003 GGG 893 51% 5 0.7299 MAPK4 MAPK4 77220
3 BRDN0001145383 TCCTGGCTGAGATGCTTACG pXPR_003 GGG 669 38% 3 0.4421 MAPK4 MAPK4 77221
4 BRDN0001145865 CAACATCGTCAAAGTGTACG pXPR_003 AGG 241 14% 2 -0.3253 MAPK4 MAPK4 77222
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011526075.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234985 ACAGTGAAGCCATCGACTTTC pLKO_005 1901 CDS 100% 10.800 15.120 N MAPK4 n/a
2 TRCN0000001378 GATCAGCATTACTCCCACAAG pLKO.1 1582 CDS 100% 4.050 5.670 N MAPK4 n/a
3 TRCN0000199437 GATCGCGCAGTGGGTCAAGAG pLKO.1 2532 CDS 100% 0.000 0.000 N MAPK4 n/a
4 TRCN0000199817 GCGACCTCAATGGTGCGTGCA pLKO.1 2741 CDS 100% 0.000 0.000 N MAPK4 n/a
5 TRCN0000234984 ATTACTCCCACAAGGGTTATC pLKO_005 1589 CDS 100% 10.800 8.640 N MAPK4 n/a
6 TRCN0000200005 CTGGAGACCATCCCTGTAATC pLKO.1 1780 CDS 100% 10.800 8.640 N MAPK4 n/a
7 TRCN0000234987 CTAGTCACCAAGCATACTTTC pLKO_005 3466 3UTR 100% 0.000 0.000 N MAPK4 n/a
8 TRCN0000234986 GAGGACCTGCCGGACAATAAA pLKO_005 2716 CDS 100% 15.000 10.500 N MAPK4 n/a
9 TRCN0000234983 ACCACGACAACATCGTCAAAG pLKO_005 1274 CDS 100% 10.800 7.560 N MAPK4 n/a
10 TRCN0000023180 CTGGAGAAGATCCTGACCTTT pLKO.1 1921 CDS 100% 4.950 3.465 N Mapk4 n/a
11 TRCN0000001376 GAAGGTCGCTGTGAAGAAGAT pLKO.1 1188 CDS 100% 4.950 3.465 N MAPK4 n/a
12 TRCN0000199263 CATCGTGCTGATGGCCGCTAA pLKO.1 2064 CDS 100% 1.350 0.945 N MAPK4 n/a
13 TRCN0000001375 ACTACACCAAAGCCATCGACA pLKO.1 1670 CDS 100% 2.640 1.584 N MAPK4 n/a
14 TRCN0000001377 AGTGAACAGTGAAGCCATCGA pLKO.1 1896 CDS 100% 2.640 1.584 N MAPK4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011526075.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01286 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01286 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472205 CCCGGTACAACTATCCGTGCCAGA pLX_317 22.5% 100% 100% V5 n/a
4 TRCN0000488020 GCGATGGCTAGATTTTCGAGTCCA pLX_317 16.9% 95% 94.5% V5 (not translated due to frame shift) 1145_1146delCG;1162delC;1677_1761del n/a
5 TRCN0000489673 GATACCCGTTCCACCGACTGCGGC pLX_317 7.7% 94.9% 84% V5 (not translated due to prior stop codon) (many diffs) n/a
6 ccsbBroadEn_14801 pDONR223 100% 43.3% 1.8% None (many diffs) n/a
7 ccsbBroad304_14801 pLX_304 0% 43.3% 1.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV