Transcript: Human NM_001292040.2

Homo sapiens mitogen-activated protein kinase 4 (MAPK4), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
MAPK4 (5596)
Length:
4387
CDS:
1028..1729

Additional Resources:

NCBI RefSeq record:
NM_001292040.2
NBCI Gene record:
MAPK4 (5596)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001292040.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001378 GATCAGCATTACTCCCACAAG pLKO.1 1553 CDS 100% 4.050 5.670 N MAPK4 n/a
2 TRCN0000199437 GATCGCGCAGTGGGTCAAGAG pLKO.1 2127 3UTR 100% 0.000 0.000 N MAPK4 n/a
3 TRCN0000199817 GCGACCTCAATGGTGCGTGCA pLKO.1 2336 3UTR 100% 0.000 0.000 N MAPK4 n/a
4 TRCN0000234984 ATTACTCCCACAAGGGTTATC pLKO_005 1560 CDS 100% 10.800 8.640 N MAPK4 n/a
5 TRCN0000234987 CTAGTCACCAAGCATACTTTC pLKO_005 3061 3UTR 100% 0.000 0.000 N MAPK4 n/a
6 TRCN0000234986 GAGGACCTGCCGGACAATAAA pLKO_005 2311 3UTR 100% 15.000 10.500 N MAPK4 n/a
7 TRCN0000234983 ACCACGACAACATCGTCAAAG pLKO_005 1245 CDS 100% 10.800 7.560 N MAPK4 n/a
8 TRCN0000001376 GAAGGTCGCTGTGAAGAAGAT pLKO.1 1159 CDS 100% 4.950 3.465 N MAPK4 n/a
9 TRCN0000001375 ACTACACCAAAGCCATCGACA pLKO.1 1641 CDS 100% 2.640 1.584 N MAPK4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001292040.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14801 pDONR223 100% 80.3% 4.6% None (many diffs) n/a
2 ccsbBroad304_14801 pLX_304 0% 80.3% 4.6% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000488020 GCGATGGCTAGATTTTCGAGTCCA pLX_317 16.9% 41.6% 41.3% V5 (not translated due to frame shift) 693_694delTAinsGG;697_698insA;699_700ins973 n/a
4 TRCN0000489673 GATACCCGTTCCACCGACTGCGGC pLX_317 7.7% 41.6% 42.3% V5 (not translated due to prior stop codon) 693_694delTAinsGG;697_698insA;699_700ins973 n/a
5 ccsbBroadEn_01286 pDONR223 100% 39.5% 39.3% None 693_694delTAinsGG;697_698insA;699_700ins1061 n/a
6 ccsbBroad304_01286 pLX_304 0% 39.5% 39.3% V5 693_694delTAinsGG;697_698insA;699_700ins1061 n/a
7 TRCN0000472205 CCCGGTACAACTATCCGTGCCAGA pLX_317 22.5% 39.5% 39.3% V5 693_694delTAinsGG;697_698insA;699_700ins1061 n/a
Download CSV