Construct: ORF TRCN0000472499
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018991.3_s317c1
- Derived from:
- ccsbBroadEn_14641
- DNA Barcode:
- CTCTCTAATATTTACACGCAAGGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FGR (2268)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472499
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 2268 | FGR | FGR proto-oncogene, Src fam... | NM_001042729.2 | 100% | 100% | |
2 | human | 2268 | FGR | FGR proto-oncogene, Src fam... | NM_001042747.1 | 100% | 100% | |
3 | human | 2268 | FGR | FGR proto-oncogene, Src fam... | NM_005248.3 | 100% | 100% | |
4 | human | 2268 | FGR | FGR proto-oncogene, Src fam... | XM_006710452.2 | 100% | 100% | |
5 | human | 2268 | FGR | FGR proto-oncogene, Src fam... | XM_011541010.1 | 100% | 100% | |
6 | human | 2268 | FGR | FGR proto-oncogene, Src fam... | XM_011541011.2 | 86.9% | 82.6% | 226_227ins103;325_326ins104 |
7 | human | 2268 | FGR | FGR proto-oncogene, Src fam... | XM_011541012.2 | 77.5% | 70.1% | 1093_1094ins154;1230_1231ins203 |
8 | human | 2268 | FGR | FGR proto-oncogene, Src fam... | XM_011541013.3 | 66.5% | 64.6% | 1017_1018insGGCA;1056_1057ins527 |
9 | human | 2268 | FGR | FGR proto-oncogene, Src fam... | XR_946583.3 | 65.6% | 1_196del;1213_1214insGGCA;1780_2407del | |
10 | human | 2268 | FGR | FGR proto-oncogene, Src fam... | XM_011541014.3 | 61.4% | 61.4% | 0_1ins612 |
11 | human | 2268 | FGR | FGR proto-oncogene, Src fam... | XM_017000673.1 | 61.4% | 61.4% | 0_1ins612 |
12 | human | 2268 | FGR | FGR proto-oncogene, Src fam... | XM_017000674.1 | 61.4% | 61.4% | 0_1ins612 |
13 | mouse | 14191 | Fgr | FGR proto-oncogene, Src fam... | NM_010208.4 | 82.8% | 84.1% | (many diffs) |
14 | mouse | 14191 | Fgr | FGR proto-oncogene, Src fam... | XM_006538544.3 | 82.8% | 84.1% | (many diffs) |
15 | mouse | 14191 | Fgr | FGR proto-oncogene, Src fam... | XM_006538545.3 | 82.8% | 84.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1656
- ORF length:
- 1587
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gggctgtgtg ttctgcaaga aattggagcc ggtggccacg gccaaggagg 121 atgctggcct ggaaggggac ttcagaagct acggggcagc agaccactat gggcctgacc 181 ccactaaggc ccggcctgca tcctcatttg cccacatccc caactacagc aacttctcct 241 ctcaggccat caaccctggc ttccttgata gtggcaccat caggggtgtg tcagggattg 301 gggtgaccct gttcattgcc ctgtatgact atgaggctcg aactgaggat gacctcacct 361 tcaccaaggg cgagaagttc cacatcctga acaatactga aggtgactgg tgggaggctc 421 ggtctctcag ctccggaaaa actggctgca ttcccagcaa ctacgtggcc cctgttgact 481 caatccaagc tgaagagtgg tactttggaa agattgggag aaaggatgca gagaggcagc 541 tgctttcacc aggcaacccc cagggggcct ttctcattcg ggaaagcgag accaccaaag 601 gtgcctactc cctgtccatc cgggactggg atcagaccag aggcgatcat gtgaagcatt 661 acaagatccg caaactggac atgggcggct actacatcac cacacgggtt cagttcaact 721 cggtgcagga gctggtgcag cactacatgg aggtgaatga cgggctgtgc aacctgctca 781 tcgcgccctg caccatcatg aagccgcaga cgctgggcct ggccaaggac gcctgggaga 841 tcagccgcag ctccatcacg ctggagcgcc ggctgggcac cggctgcttc ggggatgtgt 901 ggctgggcac gtggaacggc agcactaagg tggcggtgaa gacgctgaag ccgggcacca 961 tgtccccgaa ggccttcctg gaggaggcgc aggtcatgaa gctgctgcgg cacgacaagc 1021 tggtgcagct gtacgccgtg gtgtcggagg agcccatcta catcgtgacc gagttcatgt 1081 gtcacggcag cttgctggat tttctcaaga acccagaggg ccaggatttg aggctgcccc 1141 aattggtgga catggcagcc caggtagctg agggcatggc ctacatggaa cgcatgaact 1201 acattcaccg cgacctgagg gcagccaaca TCCTGGTTGG GGAGCGGCTG GCGTGCAAGA 1261 TCGCAGACTT TGGCTTGGCG CGTCTCATCA AGGACGATGA GTACAACCCC TGCCAAGGTT 1321 CCAAGTTCCC CATCAAGTGG ACAGCCCCAG AAGCTGCCCT CTTTGGCAGA TTCACCATCA 1381 AGTCAGACGT GTGGTCCTTT GGGATCCTGC TCACTGAGCT CATCACCAAG GGCCGAATCC 1441 CCTACCCAGG CATGAATAAA CGGGAAGTGT TGGAACAGGT GGAGCAGGGC TACCACATGC 1501 CGTGCCCTCC AGGCTGCCCA GCATCCCTGT ACGAGGCCAT GGAACAGACC TGGCGTCTGG 1561 ACCCGGAGGA GAGGCCTACC TTCGAGTACC TGCAGTCCTT CCTGGAGGAC TACTTCACCT 1621 CCGCTGAACC ACAGTACCAG CCCGGGGATC AGACACCAAC TTTCTTGTAC AAAGTGGTTG 1681 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 1741 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGACT 1801 CTCTAATATT TACACGCAAG GTACGCGTTA AGTCgacaat caacctctgg attacaaaat 1861 ttgtgaaaga tt