Transcript: Human XM_017000674.1

PREDICTED: Homo sapiens FGR proto-oncogene, Src family tyrosine kinase (FGR), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FGR (2268)
Length:
1998
CDS:
396..1373

Additional Resources:

NCBI RefSeq record:
XM_017000674.1
NBCI Gene record:
FGR (2268)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000674.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197132 GAACGCATGAACTACATTCAC pLKO.1 903 CDS 100% 4.950 3.960 N FGR n/a
2 TRCN0000199582 GCGTGCAAGATCGCAGACTTT pLKO.1 966 CDS 100% 4.950 3.465 N FGR n/a
3 TRCN0000199350 CCCTCTATTCTCTTGTGTCTG pLKO.1 1780 3UTR 100% 4.050 2.835 N FGR n/a
4 TRCN0000001595 GCATGAATAAACGGGAAGTGT pLKO.1 1165 CDS 100% 3.000 2.100 N FGR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000674.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00564 pDONR223 100% 61.4% 61.4% None 0_1ins612 n/a
2 ccsbBroad304_00564 pLX_304 0% 61.4% 61.4% V5 0_1ins612 n/a
3 TRCN0000478102 CGGACTTCGCGTGCGTAGGTCTTC pLX_317 21.4% 61.4% 61.4% V5 0_1ins612 n/a
4 ccsbBroadEn_14641 pDONR223 0% 61.4% 61.4% None 0_1ins612 n/a
5 ccsbBroad304_14641 pLX_304 0% 61.4% 61.4% V5 0_1ins612 n/a
6 TRCN0000472499 CTCTCTAATATTTACACGCAAGGT pLX_317 26.9% 61.4% 61.4% V5 0_1ins612 n/a
7 TRCN0000492193 ACATCTCGAATCGGTTGGCTTTCC pLX_317 11% 61.4% 61.4% V5 (not translated due to prior stop codon) 0_1ins612 n/a
Download CSV