Construct: ORF TRCN0000472504
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018826.3_s317c1
- Derived from:
- ccsbBroadEn_15016
- DNA Barcode:
- CACTGAATGCCTGCCTTCCGGAAG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- DAPK2 (23604)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472504
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 23604 | DAPK2 | death associated protein ki... | NM_014326.5 | 99.4% | 33.5% | (many diffs) |
| 2 | human | 23604 | DAPK2 | death associated protein ki... | XM_017022044.1 | 93.3% | 35.4% | (many diffs) |
| 3 | human | 23604 | DAPK2 | death associated protein ki... | XM_011521414.1 | 90.8% | 32.6% | (many diffs) |
| 4 | human | 23604 | DAPK2 | death associated protein ki... | XM_011521413.2 | 90.7% | 31.8% | (many diffs) |
| 5 | human | 23604 | DAPK2 | death associated protein ki... | XM_011521417.1 | 84.9% | 39.2% | (many diffs) |
| 6 | human | 23604 | DAPK2 | death associated protein ki... | XM_017022045.1 | 84.9% | 39.2% | (many diffs) |
| 7 | human | 23604 | DAPK2 | death associated protein ki... | XM_017022046.1 | 84.9% | 39.2% | (many diffs) |
| 8 | human | 23604 | DAPK2 | death associated protein ki... | XM_011521415.3 | 80.3% | 34.5% | (many diffs) |
| 9 | human | 23604 | DAPK2 | death associated protein ki... | NM_001363730.2 | 70.9% | 25.4% | (many diffs) |
| 10 | human | 23604 | DAPK2 | death associated protein ki... | XM_017022043.1 | 55.5% | 21.4% | (many diffs) |
| 11 | human | 23604 | DAPK2 | death associated protein ki... | XM_011521421.3 | 51.8% | 10.7% | (many diffs) |
| 12 | human | 23604 | DAPK2 | death associated protein ki... | XM_017022047.1 | 39.6% | 6.2% | (many diffs) |
| 13 | human | 23604 | DAPK2 | death associated protein ki... | XM_017022048.2 | 39.6% | 6.2% | (many diffs) |
| 14 | human | 23604 | DAPK2 | death associated protein ki... | XM_017022049.1 | 39.6% | 6.2% | (many diffs) |
| 15 | human | 23604 | DAPK2 | death associated protein ki... | XM_017022050.1 | 39.6% | 6.2% | (many diffs) |
| 16 | human | 23604 | DAPK2 | death associated protein ki... | XM_017022051.1 | 39.6% | 6.2% | (many diffs) |
| 17 | mouse | 13143 | Dapk2 | death-associated protein ki... | NM_010019.3 | 91.3% | 32.1% | (many diffs) |
| 18 | mouse | 13143 | Dapk2 | death-associated protein ki... | XM_006510811.2 | 52.6% | 9.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 459
- ORF length:
- 390
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gttccaggcc tcaatgagga gtccaaacat ggagccattc aagcagcaga 121 aggtggagga cttttatgac atcggagagg agctggggag tggccagttt gccatcgtga 181 agaagtgccg ggagaagagc acggggcttg agtatgcagc caagttcatc aagaagcggc 241 agagccgggc gagccggcgc ggtgtgagcc gggaggagat cgagcgggag gtgagcatcc 301 tgcggcaggt gctgcaccac aatgtcatca cgctgcacga cgtctatgag aaccgcaccg 361 acgtggtgct catccttgag ctagtgtctg gaggagagct cttcgatttc ctggcccaga 421 aggagtcact gagtgangan gangccaccc agcttcatta agcagatcct ggatggggtg 481 aactaccttc acacaaagaa aattgctcac tttgatctca agccagaaaa cattatgttg 541 ttagacaaga atattcccat tccacacatc aagctgattg actttggtct ggctcacgaa 601 atagaagatg gagttgaatt taagaatatt tttggggacg ccggaatttg ttgctccaga 661 aattgtgaac tacgagcccc tggggtctgg aggctgacat gtggagcata ggcgtcatca 721 cctacatcct cttaagtgga gcatcccctt tccTGGGAGA CACGAAGCAG GAAACACTGG 781 CAAATATCAC AGCAGTGAGT TACGACTTTG ATGAGGAATT CTTCAGCCAG ACGAGCGAGC 841 TGGCCAAGGA CTTTATTCGG AAGCTTCTGG TTAAAGAGAC CCGGAAACGG CTCACAATCC 901 AAGAGGCTCT CAGACACCCC TGGATCACGC CGGTGGACAA CCAGCAAGCC ATGGTGCGCA 961 GGGAGTCTGT GGTCAATCTG GAGAACTTCA GGAAGCAGTA TGTCCGCAGG CGGTGGAAGC 1021 TTTCCTTCAG CATCGTGTCC CTGTGCAACC ACCTCACCCG CTCGCTGATG AAGAAGGTGC 1081 ACCTGAGGCC GGATGAGGAC CTGAGGAACT GTGAGAGTGA CACTGAGGAG GACATCGCCA 1141 GGAGGAAAGC CCTCCACCCA CGGAGGAGGA GCAGCACCTC CTTGCCAACT TTCTTGTACA 1201 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1261 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1321 AGGACGACAC TGAATGCCTG CCTTCCGGAA GACGCGTTAA GTCgacaatc aacctctgga 1381 ttacaaaatt tgtgaaagat t