Transcript: Human XM_011521417.1

PREDICTED: Homo sapiens death associated protein kinase 2 (DAPK2), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DAPK2 (23604)
Length:
1670
CDS:
7..957

Additional Resources:

NCBI RefSeq record:
XM_011521417.1
NBCI Gene record:
DAPK2 (23604)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521417.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195542 CAGGAAACACTGGCAAATATC pLKO.1 703 CDS 100% 13.200 9.240 N DAPK2 n/a
2 TRCN0000352678 CAGGAAACACTGGCAAATATC pLKO_005 703 CDS 100% 13.200 9.240 N DAPK2 n/a
3 TRCN0000001719 TCATCACCTACATCCTCTTAA pLKO.1 650 CDS 100% 13.200 9.240 N DAPK2 n/a
4 TRCN0000195455 CCACACATCAAGCTGATTGAC pLKO.1 499 CDS 100% 4.950 3.465 N DAPK2 n/a
5 TRCN0000001721 GTTACGACTTTGATGAGGAAT pLKO.1 734 CDS 100% 4.950 3.465 N DAPK2 n/a
6 TRCN0000342401 GTTACGACTTTGATGAGGAAT pLKO_005 734 CDS 100% 4.950 3.465 N DAPK2 n/a
7 TRCN0000220669 CACCAGCTTCATTAAGCAGAT pLKO.1 384 CDS 100% 4.050 2.835 N Dapk2 n/a
8 TRCN0000001720 CACGAAATAGAAGATGGAGTT pLKO.1 532 CDS 100% 4.050 2.835 N DAPK2 n/a
9 TRCN0000352613 CACGAAATAGAAGATGGAGTT pLKO_005 532 CDS 100% 4.050 2.835 N DAPK2 n/a
10 TRCN0000199968 CCTGAGCACTTTGCAAGAGAG pLKO.1 1172 3UTR 100% 4.050 2.835 N DAPK2 n/a
11 TRCN0000196486 GAAGATGGAGTTGAATTTAAG pLKO.1 541 CDS 100% 13.200 7.920 N DAPK2 n/a
12 TRCN0000001722 TGCTCCAGAAATTGTGAACTA pLKO.1 588 CDS 100% 4.950 2.970 N DAPK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521417.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02809 pDONR223 100% 85.4% 74.4% None 810_811ins46;948_949ins116 n/a
2 ccsbBroad304_02809 pLX_304 0% 85.4% 74.4% V5 810_811ins46;948_949ins116 n/a
3 ccsbBroadEn_15016 pDONR223 100% 84.9% 39.2% None (many diffs) n/a
4 ccsbBroad304_15016 pLX_304 0% 84.9% 39.2% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000472504 CACTGAATGCCTGCCTTCCGGAAG pLX_317 38.6% 84.9% 39.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV