Transcript: Human NM_001363730.2

Homo sapiens death associated protein kinase 2 (DAPK2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
DAPK2 (23604)
Length:
8252
CDS:
195..1661

Additional Resources:

NCBI RefSeq record:
NM_001363730.2
NBCI Gene record:
DAPK2 (23604)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001144830 AGACACGAAGCAGGAAACAC pXPR_003 TGG 703 48% 8 0.7328 DAPK2 DAPK2 76022
2 BRDN0001145554 TCATTAAGCAGATCCTGGAT pXPR_003 GGG 402 27% 4 0.6252 DAPK2 DAPK2 76019
3 BRDN0001149391 AGTGCCGGGAGAAGAGCACG pXPR_003 GGG 132 9% 3 0.4249 DAPK2 DAPK2 76021
4 BRDN0001149451 CTATGAGAACCGCACCGACG pXPR_003 TGG 292 20% 3 0.1646 DAPK2 DAPK2 76020
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363730.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195542 CAGGAAACACTGGCAAATATC pLKO.1 891 CDS 100% 13.200 9.240 N DAPK2 n/a
2 TRCN0000352678 CAGGAAACACTGGCAAATATC pLKO_005 891 CDS 100% 13.200 9.240 N DAPK2 n/a
3 TRCN0000001719 TCATCACCTACATCCTCTTAA pLKO.1 838 CDS 100% 13.200 9.240 N DAPK2 n/a
4 TRCN0000195455 CCACACATCAAGCTGATTGAC pLKO.1 687 CDS 100% 4.950 3.465 N DAPK2 n/a
5 TRCN0000001721 GTTACGACTTTGATGAGGAAT pLKO.1 922 CDS 100% 4.950 3.465 N DAPK2 n/a
6 TRCN0000342401 GTTACGACTTTGATGAGGAAT pLKO_005 922 CDS 100% 4.950 3.465 N DAPK2 n/a
7 TRCN0000220669 CACCAGCTTCATTAAGCAGAT pLKO.1 572 CDS 100% 4.050 2.835 N Dapk2 n/a
8 TRCN0000001720 CACGAAATAGAAGATGGAGTT pLKO.1 720 CDS 100% 4.050 2.835 N DAPK2 n/a
9 TRCN0000352613 CACGAAATAGAAGATGGAGTT pLKO_005 720 CDS 100% 4.050 2.835 N DAPK2 n/a
10 TRCN0000196486 GAAGATGGAGTTGAATTTAAG pLKO.1 729 CDS 100% 13.200 7.920 N DAPK2 n/a
11 TRCN0000001722 TGCTCCAGAAATTGTGAACTA pLKO.1 776 CDS 100% 4.950 2.970 N DAPK2 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4631 3UTR 100% 13.200 6.600 Y LIAS n/a
13 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 4806 3UTR 100% 4.950 2.475 Y DCAF11 n/a
14 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 4669 3UTR 100% 4.050 2.025 Y P3H4 n/a
15 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 4669 3UTR 100% 4.050 2.025 Y ORAI2 n/a
16 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 4669 3UTR 100% 4.050 2.025 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363730.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02809 pDONR223 100% 71.2% 59.8% None (many diffs) n/a
2 ccsbBroad304_02809 pLX_304 0% 71.2% 59.8% V5 (many diffs) n/a
3 ccsbBroadEn_15016 pDONR223 100% 70.9% 25.4% None (many diffs) n/a
4 ccsbBroad304_15016 pLX_304 0% 70.9% 25.4% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000472504 CACTGAATGCCTGCCTTCCGGAAG pLX_317 38.6% 70.9% 25.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV