Transcript: Human XM_017022048.2

PREDICTED: Homo sapiens death associated protein kinase 2 (DAPK2), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DAPK2 (23604)
Length:
4084
CDS:
232..1233

Additional Resources:

NCBI RefSeq record:
XM_017022048.2
NBCI Gene record:
DAPK2 (23604)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022048.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195542 CAGGAAACACTGGCAAATATC pLKO.1 463 CDS 100% 13.200 9.240 N DAPK2 n/a
2 TRCN0000352678 CAGGAAACACTGGCAAATATC pLKO_005 463 CDS 100% 13.200 9.240 N DAPK2 n/a
3 TRCN0000001719 TCATCACCTACATCCTCTTAA pLKO.1 410 CDS 100% 13.200 9.240 N DAPK2 n/a
4 TRCN0000195455 CCACACATCAAGCTGATTGAC pLKO.1 259 CDS 100% 4.950 3.465 N DAPK2 n/a
5 TRCN0000001721 GTTACGACTTTGATGAGGAAT pLKO.1 494 CDS 100% 4.950 3.465 N DAPK2 n/a
6 TRCN0000342401 GTTACGACTTTGATGAGGAAT pLKO_005 494 CDS 100% 4.950 3.465 N DAPK2 n/a
7 TRCN0000001720 CACGAAATAGAAGATGGAGTT pLKO.1 292 CDS 100% 4.050 2.835 N DAPK2 n/a
8 TRCN0000352613 CACGAAATAGAAGATGGAGTT pLKO_005 292 CDS 100% 4.050 2.835 N DAPK2 n/a
9 TRCN0000196486 GAAGATGGAGTTGAATTTAAG pLKO.1 301 CDS 100% 13.200 7.920 N DAPK2 n/a
10 TRCN0000001722 TGCTCCAGAAATTGTGAACTA pLKO.1 348 CDS 100% 4.950 2.970 N DAPK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022048.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02809 pDONR223 100% 39.7% 29.3% None (many diffs) n/a
2 ccsbBroad304_02809 pLX_304 0% 39.7% 29.3% V5 (many diffs) n/a
3 ccsbBroadEn_15016 pDONR223 100% 39.6% 6.2% None (many diffs) n/a
4 ccsbBroad304_15016 pLX_304 0% 39.6% 6.2% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000472504 CACTGAATGCCTGCCTTCCGGAAG pLX_317 38.6% 39.6% 6.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV