Construct: ORF TRCN0000472506
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018798.3_s317c1
- Derived from:
- ccsbBroadEn_15339
- DNA Barcode:
- CCGCAGGAGGTCCTACTGGGGCTC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- HIPK2 (28996)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472506
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 28996 | HIPK2 | homeodomain interacting pro... | NM_001113239.3 | 30.7% | 8.8% | (many diffs) |
| 2 | human | 28996 | HIPK2 | homeodomain interacting pro... | XM_006715935.2 | 30.2% | 8.7% | (many diffs) |
| 3 | human | 28996 | HIPK2 | homeodomain interacting pro... | XM_017012069.1 | 30.2% | 8.7% | (many diffs) |
| 4 | human | 28996 | HIPK2 | homeodomain interacting pro... | NM_022740.5 | 30% | 8.6% | (many diffs) |
| 5 | human | 28996 | HIPK2 | homeodomain interacting pro... | XM_011516081.2 | 29.8% | 8.6% | (many diffs) |
| 6 | human | 28996 | HIPK2 | homeodomain interacting pro... | XM_011516080.3 | 26.7% | 7.7% | (many diffs) |
| 7 | human | 28996 | HIPK2 | homeodomain interacting pro... | XM_011516079.3 | 26.7% | 7.7% | (many diffs) |
| 8 | human | 28996 | HIPK2 | homeodomain interacting pro... | XM_011516078.3 | 26.1% | 7.5% | (many diffs) |
| 9 | human | 28996 | HIPK2 | homeodomain interacting pro... | XM_011516077.3 | 26.1% | 7.5% | (many diffs) |
| 10 | mouse | 15258 | Hipk2 | homeodomain interacting pro... | NM_001136065.2 | 28.5% | 8.5% | (many diffs) |
| 11 | mouse | 15258 | Hipk2 | homeodomain interacting pro... | NM_001294144.1 | 28.3% | 8.4% | (many diffs) |
| 12 | mouse | 15258 | Hipk2 | homeodomain interacting pro... | NM_001294143.1 | 28.3% | 8.4% | (many diffs) |
| 13 | mouse | 15258 | Hipk2 | homeodomain interacting pro... | XM_006505603.3 | 27.8% | 8.3% | (many diffs) |
| 14 | mouse | 15258 | Hipk2 | homeodomain interacting pro... | XM_006505602.3 | 27.7% | 8.2% | (many diffs) |
| 15 | mouse | 15258 | Hipk2 | homeodomain interacting pro... | NM_010433.2 | 27.7% | 8.2% | (many diffs) |
| 16 | mouse | 15258 | Hipk2 | homeodomain interacting pro... | XR_001785097.1 | 6.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 390
- ORF length:
- 321
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggcctcacat gtgcaagttt tctcccctca cacccttcaa tcaagtgcct 121 tctgtagtgt gaagaaactg aaaatagagc cgagttccaa ctgggacatg actgggtacg 181 gctcccacag caaagtgtat agccagagca agaacatccc cctgtcgcag ccagccacca 241 caaccgtcag cacctccttg ccggtcccaa acccaagcct accttacgag cagaccatcg 301 tcttcccagg aagcaccggg cacatcgtgg tcacctcagc aagcagcact tctgtcaccg 361 ggcaagtcct cggcggacca ccacaacctt aatgcgtcga agcactgtga gcctccttga 421 tacctaccaa aaatgtggac tcaagcgtaa gagcgaggag atcgagaaca caagcagcgt 481 gcagatcatc gaggagcatc cacccatgat tcagaataat gcaagcgggg ccactgtcgc 541 cactgccacc acgtctactg ccacctccaa aaacagcggc tccaacagcg agggcgacta 601 tcagctggtg cagcatgagg tgctgtgctc catgaccaac acctacgagg tcttagagtt 661 cttgggccga gggacgtttg ggcaagtggt caagtgctgg aaacggggca ccaatgagat 721 cgtagccatc aagatcctga agnaCCACCC ATCCTATGCC CGACAAGGTC AGATTGAAGT 781 GAGCATCCTG GCCCGGTTGA GCACGGAGAG TGCCGATGAC TATAACTTCG TCCGGGCCTA 841 CGAATGCTTC CAGCACAAGA ACCACACGTG CTTGGTCTTC GAGATGTTGG AGCAGAACCT 901 CTATGACTTT CTGAAGCAAA ACAAGTTTAG CCCCTTGCCC CTCAAATACA TTCGCCCAGT 961 TCTCCAGCAG GTAGCCACAG CCCTGATGAA ACTCAAAAGC CTAGGTCTTA TCCACGCTGA 1021 CCTCAAACCA GAAAACATCA TGCTGGTGGA TCCATCTAGA CAACCATACA GAGTCAAGGT 1081 CATCGACTTT GGTTCAGCCA GCCACGTCTC CAAGGCTGTG TGCTCCACCT ACTTGCAGTC 1141 CAGATATTAC AGGTTGCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC 1201 TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT 1261 TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAC CGCAGGAGGT CCTACTGGGG 1321 CTCACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag att