Transcript: Human XM_011516077.3

PREDICTED: Homo sapiens homeodomain interacting protein kinase 2 (HIPK2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HIPK2 (28996)
Length:
15802
CDS:
312..4445

Additional Resources:

NCBI RefSeq record:
XM_011516077.3
NBCI Gene record:
HIPK2 (28996)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001162198 TCGGGTGAATATGTATGACA pXPR_003 CGG 2212 54% 7 1.2121 HIPK2 HIPK2 76751
2 BRDN0001148687 TAAACCAAGGATGATCTCAG pXPR_003 GGG 1648 40% 3 1.185 HIPK2 HIPK2 76749
3 BRDN0001147868 ACTGGGCGAATGTATTTGAG pXPR_003 GGG 1431 35% 2 0.929 HIPK2 HIPK2 76752
4 BRDN0001162222 TGGACTCAAGCGTAAGAGCG pXPR_003 AGG 940 23% 2 -0.0094 HIPK2 HIPK2 76750
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011516077.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361235 TCCCGAAGTCTCCATACTAAA pLKO_005 2669 CDS 100% 13.200 18.480 N Hipk2 n/a
2 TRCN0000425963 AGAACCCATTCTACGCCAAAC pLKO_005 4787 3UTR 100% 6.000 8.400 N HIPK2 n/a
3 TRCN0000003204 CCATACTAAACTACCCATCTA pLKO.1 2680 CDS 100% 4.950 6.930 N HIPK2 n/a
4 TRCN0000197283 GCTCACGGAAGCCATTATAAT pLKO.1 3114 CDS 100% 15.000 12.000 N HIPK2 n/a
5 TRCN0000003203 CGGGACAAAGACAACTAGGTT pLKO.1 2129 CDS 100% 3.000 2.400 N HIPK2 n/a
6 TRCN0000023014 CCACCCATGATTCAGAATAAT pLKO.1 1299 CDS 100% 15.000 10.500 N Hipk2 n/a
7 TRCN0000414399 TTCCTGGGTTGGCCGTTATAT pLKO_005 2031 CDS 100% 15.000 10.500 N HIPK2 n/a
8 TRCN0000433047 CCCACAGCACACACGTCAAAT pLKO_005 2455 CDS 100% 13.200 9.240 N HIPK2 n/a
9 TRCN0000199557 CCTCTACCAGTGCCACTATTT pLKO.1 2638 CDS 100% 13.200 9.240 N HIPK2 n/a
10 TRCN0000435008 CCTGATATGGAAATCAAATAG pLKO_005 4937 3UTR 100% 13.200 9.240 N HIPK2 n/a
11 TRCN0000361288 GTATGATCAGATTCGGTATAT pLKO_005 2066 CDS 100% 13.200 9.240 N Hipk2 n/a
12 TRCN0000003201 CGAGTCAGTATCCAGCCCAAT pLKO.1 4327 CDS 100% 4.050 2.835 N HIPK2 n/a
13 TRCN0000010766 AGGGATTAAAGAGGGTGGGAA pLKO.1 4699 3UTR 100% 2.640 1.848 N HIPK2 n/a
14 TRCN0000003202 CCTGACCATGACCTTTAACAA pLKO.1 2585 CDS 100% 5.625 3.375 N HIPK2 n/a
15 TRCN0000023015 CGGGAGTTCATTGACCTGTTA pLKO.1 2340 CDS 100% 4.950 6.930 N Hipk2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011516077.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15049 pDONR223 67.9% 56.5% 20% None (many diffs) n/a
2 ccsbBroad304_15049 pLX_304 0% 56.5% 20% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000473659 TATGTCACATGTATTCCAATTGAC pLX_317 16.3% 56.5% 20% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000472506 CCGCAGGAGGTCCTACTGGGGCTC pLX_317 37.9% 26.1% 7.5% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_15339 pDONR223 100% 26% 7.5% None (many diffs) n/a
6 ccsbBroad304_15339 pLX_304 0% 26% 7.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV