Transcript: Mouse NM_010433.2

Mus musculus homeodomain interacting protein kinase 2 (Hipk2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-15
Taxon:
Mus musculus (mouse)
Gene:
Hipk2 (15258)
Length:
4259
CDS:
374..3964

Additional Resources:

NCBI RefSeq record:
NM_010433.2
NBCI Gene record:
Hipk2 (15258)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010433.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023014 CCACCCATGATTCAGAATAAT pLKO.1 824 CDS 100% 15.000 21.000 N Hipk2 n/a
2 TRCN0000378475 GAGCGCTGATGACTACAATTT pLKO_005 1132 CDS 100% 13.200 18.480 N Hipk2 n/a
3 TRCN0000361236 TTTGCCCACCAGACCTATATC pLKO_005 3866 CDS 100% 13.200 10.560 N Hipk2 n/a
4 TRCN0000023015 CGGGAGTTCATTGACCTGTTA pLKO.1 1865 CDS 100% 4.950 3.960 N Hipk2 n/a
5 TRCN0000361289 ATGAAGCAGAGACGGGAATTA pLKO_005 1734 CDS 100% 13.200 9.240 N Hipk2 n/a
6 TRCN0000361288 GTATGATCAGATTCGGTATAT pLKO_005 1591 CDS 100% 13.200 9.240 N Hipk2 n/a
7 TRCN0000361235 TCCCGAAGTCTCCATACTAAA pLKO_005 2194 CDS 100% 13.200 9.240 N Hipk2 n/a
8 TRCN0000023016 CCAGTGAAGTGTTGGTAGAAT pLKO.1 3300 CDS 100% 5.625 3.938 N Hipk2 n/a
9 TRCN0000023018 GTCAACCAATACCCTTACATA pLKO.1 3941 CDS 100% 5.625 3.938 N Hipk2 n/a
10 TRCN0000023017 CGTATCCTTTGTGGAGGCTAA pLKO.1 1698 CDS 100% 4.050 2.835 N Hipk2 n/a
11 TRCN0000430874 GCACACAAACAATGCAATGGG pLKO_005 4048 3UTR 100% 2.640 1.848 N Hipk2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010433.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15049 pDONR223 67.9% 58.5% 22.7% None (many diffs) n/a
2 ccsbBroad304_15049 pLX_304 0% 58.5% 22.7% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000473659 TATGTCACATGTATTCCAATTGAC pLX_317 16.3% 58.5% 22.7% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000472506 CCGCAGGAGGTCCTACTGGGGCTC pLX_317 37.9% 27.7% 8.2% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_15339 pDONR223 100% 27.5% 8.2% None (many diffs) n/a
6 ccsbBroad304_15339 pLX_304 0% 27.5% 8.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV