Transcript: Human NM_001113239.3

Homo sapiens homeodomain interacting protein kinase 2 (HIPK2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
HIPK2 (28996)
Length:
15248
CDS:
376..3891

Additional Resources:

NCBI RefSeq record:
NM_001113239.3
NBCI Gene record:
HIPK2 (28996)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001113239.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425963 AGAACCCATTCTACGCCAAAC pLKO_005 4233 3UTR 100% 6.000 8.400 N HIPK2 n/a
2 TRCN0000197283 GCTCACGGAAGCCATTATAAT pLKO.1 2560 CDS 100% 15.000 12.000 N HIPK2 n/a
3 TRCN0000003203 CGGGACAAAGACAACTAGGTT pLKO.1 1656 CDS 100% 3.000 2.400 N HIPK2 n/a
4 TRCN0000023014 CCACCCATGATTCAGAATAAT pLKO.1 826 CDS 100% 15.000 10.500 N Hipk2 n/a
5 TRCN0000414399 TTCCTGGGTTGGCCGTTATAT pLKO_005 1558 CDS 100% 15.000 10.500 N HIPK2 n/a
6 TRCN0000433047 CCCACAGCACACACGTCAAAT pLKO_005 1982 CDS 100% 13.200 9.240 N HIPK2 n/a
7 TRCN0000435008 CCTGATATGGAAATCAAATAG pLKO_005 4383 3UTR 100% 13.200 9.240 N HIPK2 n/a
8 TRCN0000361288 GTATGATCAGATTCGGTATAT pLKO_005 1593 CDS 100% 13.200 9.240 N Hipk2 n/a
9 TRCN0000003201 CGAGTCAGTATCCAGCCCAAT pLKO.1 3773 CDS 100% 4.050 2.835 N HIPK2 n/a
10 TRCN0000010766 AGGGATTAAAGAGGGTGGGAA pLKO.1 4145 3UTR 100% 2.640 1.848 N HIPK2 n/a
11 TRCN0000003202 CCTGACCATGACCTTTAACAA pLKO.1 2112 CDS 100% 5.625 3.375 N HIPK2 n/a
12 TRCN0000023015 CGGGAGTTCATTGACCTGTTA pLKO.1 1867 CDS 100% 4.950 6.930 N Hipk2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001113239.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15049 pDONR223 67.9% 66.4% 23.5% None (many diffs) n/a
2 ccsbBroad304_15049 pLX_304 0% 66.4% 23.5% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000473659 TATGTCACATGTATTCCAATTGAC pLX_317 16.3% 66.4% 23.5% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000472506 CCGCAGGAGGTCCTACTGGGGCTC pLX_317 37.9% 30.7% 8.8% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_15339 pDONR223 100% 30.6% 8.8% None (many diffs) n/a
6 ccsbBroad304_15339 pLX_304 0% 30.6% 8.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV