Construct: ORF TRCN0000472590
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012182.1_s317c1
- Derived from:
- ccsbBroadEn_08419
- DNA Barcode:
- TTAAAAGTCACTAAATATTTTCCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PAQR5 (54852)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472590
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 54852 | PAQR5 | progestin and adipoQ recept... | NM_001104554.1 | 99.8% | 99.6% | 71T>C |
| 2 | human | 54852 | PAQR5 | progestin and adipoQ recept... | NM_017705.4 | 99.8% | 99.6% | 71T>C |
| 3 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_011521720.2 | 99.8% | 99.6% | 71T>C |
| 4 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_017022360.1 | 99.8% | 99.6% | 71T>C |
| 5 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_017022361.1 | 99.8% | 99.6% | 71T>C |
| 6 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_017022362.1 | 99.8% | 99.6% | 71T>C |
| 7 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_017022363.1 | 99.8% | 99.6% | 71T>C |
| 8 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_017022364.1 | 99.8% | 99.6% | 71T>C |
| 9 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_024449966.1 | 99.8% | 99.6% | 71T>C |
| 10 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_005254495.4 | 95.4% | 94.8% | (many diffs) |
| 11 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_011521723.2 | 86.6% | 86.6% | 0_1ins132 |
| 12 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_024449967.1 | 68.5% | 50.2% | (many diffs) |
| 13 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_011521725.2 | 66.2% | 66% | 71T>C;178_179ins333 |
| 14 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_017022366.1 | 65.1% | 60.8% | 0_1ins139;39_40ins206 |
| 15 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_011521727.2 | 64.4% | 60.5% | 71T>C;608_609ins142;639_640ins209 |
| 16 | human | 54852 | PAQR5 | progestin and adipoQ recept... | XM_017022368.1 | 53% | 53% | 0_1ins132;46_47ins333 |
| 17 | mouse | 74090 | Paqr5 | progestin and adipoQ recept... | NM_028748.2 | 88.2% | 91.2% | (many diffs) |
| 18 | mouse | 74090 | Paqr5 | progestin and adipoQ recept... | XM_006511508.3 | 84.4% | 86.9% | (many diffs) |
| 19 | mouse | 74090 | Paqr5 | progestin and adipoQ recept... | XM_006511509.2 | 70.6% | 72.4% | (many diffs) |
| 20 | mouse | 74090 | Paqr5 | progestin and adipoQ recept... | XM_006511510.2 | 57.2% | 55.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1056
- ORF length:
- 990
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgct gagcctgaag ctccccaggc tgtttagcat agaccagata ccccaggtgt 121 tccatgagca aggcaccctg ttcggctacc gccatccaca gagttctgcc actgcctgca 181 tcctcagcct tttccaaatg accaatgaga ctctcaacat ttggactcac ttgctgccct 241 tctggttctt tgcatggagg tttgtgactg cactgtatat gacagacatc aagaatgaca 301 gctactcctg gcccatgctt gtgtacatgt gcaccagctg cgtgtaccca cttgtgtcca 361 gctgtgcgca caccttcagc tctatgtcca agaatgcccg gcacatttgc tacttcctgg 421 actatggtgc cgtcaacctc ttcagcctgg gctcagccat tgcctactct gcatacacgt 481 tcccggatgc gctcatgtgc accactttcc atgactacta cgtggccctg gctgtactga 541 acaccatcct cagcacaggc ctctcctgct actccaggtt tcttgaaatc cagaagccca 601 gactctgtaa ggtgattcgt gtcctcgcct ttgcttatcc gtacacctgg gactccctcc 661 ccatcttcta caggctattc ctgttcccag ggGAGAGTGC ACAAAATGAA GCCACCTCGT 721 ACCACCAGAA GCACATGATC ATGACCCTCC TGGCCTCTTT CTTGTACTCT GCACATCTGC 781 CAGAACGCCT AGCCCCTGGA CGCTTTGACT ACATCGGTCA CAGTCACCAG CTGTTTCACG 841 TGTGTGTGAT CCTGGCCACG CACATGCAGA TGGAAGCCAT ACTTCTGGAC AAGACTCTGA 901 GGAAGGAATG GCTCCTGGCC ACCTCCAAGC CCTTCTCTTT CTCTCAGATA GCTGGAGCCA 961 TACTTCTGTG CATCATCTTC AGCCTCAGCA ACATAATTTA TTTCTCAGCT GCTCTGTATC 1021 GGATTCCCAA GCCAGAATTA CATAAAAAAG AAACATGCCC AACTTTCTTG TACAAAGTGG 1081 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1141 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1201 ATTAAAAGTC ACTAAATATT TTCCGACGCG TTAAGTCgac aatcaacctc tggattacaa 1261 aatttgtgaa agatt