Transcript: Human NM_001350521.2

Homo sapiens phosphodiesterase 4D interacting protein (PDE4DIP), transcript variant 11, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
PDE4DIP (9659)
Length:
8381
CDS:
72..7454

Additional Resources:

NCBI RefSeq record:
NM_001350521.2
NBCI Gene record:
PDE4DIP (9659)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350521.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048839 CGGAACATTGAGCTGAAGGTT pLKO.1 621 CDS 100% 3.000 2.100 N PDE4DIP n/a
2 TRCN0000048840 CGAGAACTCCAGGACAAGAAA pLKO.1 660 CDS 100% 5.625 2.813 Y PDE4DIP n/a
3 TRCN0000048841 GAGAATCTCAACAGTCAGAAT pLKO.1 711 CDS 100% 4.950 2.475 Y PDE4DIP n/a
4 TRCN0000048842 GAAGGAGAACTTCAGCCTCAA pLKO.1 530 CDS 100% 4.050 2.025 Y PDE4DIP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350521.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07462 pDONR223 100% 37.2% 31% None (many diffs) n/a
2 ccsbBroad304_07462 pLX_304 0% 37.2% 31% V5 (many diffs) n/a
3 TRCN0000473671 ATACATCCAACTTCAGTAGTATCG pLX_317 9.4% 37.2% 31% V5 (many diffs) n/a
4 ccsbBroadEn_07461 pDONR223 100% 12.5% 12.5% None 557T>C;738C>G;931_7380del n/a
5 ccsbBroad304_07461 pLX_304 0% 12.5% 12.5% V5 557T>C;738C>G;931_7380del n/a
6 TRCN0000472710 GAATTCGTGAGATAATCGGGTTTT pLX_317 41.8% 12.5% 12.5% V5 557T>C;738C>G;931_7380del n/a
7 ccsbBroadEn_15673 pDONR223 0% 7% 6.7% None (many diffs) n/a
8 ccsbBroad304_15673 pLX_304 0% 7% 6.7% V5 (many diffs) n/a
9 TRCN0000480000 TACACGGTCCCAAACAGCCATTTC pLX_317 77.2% 7% 6.7% V5 (many diffs) n/a
10 ccsbBroadEn_11397 pDONR223 100% 6.9% 6.5% None (many diffs) n/a
11 ccsbBroad304_11397 pLX_304 0% 6.9% 6.5% V5 (many diffs) n/a
12 TRCN0000473601 TCACCCAGAGTGGGACCCCTTAAC pLX_317 81.1% 6.9% 6.5% V5 (many diffs) n/a
Download CSV