Transcript: Human NM_001002810.3

Homo sapiens phosphodiesterase 4D interacting protein (PDE4DIP), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
PDE4DIP (9659)
Length:
1278
CDS:
303..824

Additional Resources:

NCBI RefSeq record:
NM_001002810.3
NBCI Gene record:
PDE4DIP (9659)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001002810.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048839 CGGAACATTGAGCTGAAGGTT pLKO.1 441 CDS 100% 3.000 2.100 N PDE4DIP n/a
2 TRCN0000048840 CGAGAACTCCAGGACAAGAAA pLKO.1 480 CDS 100% 5.625 2.813 Y PDE4DIP n/a
3 TRCN0000048841 GAGAATCTCAACAGTCAGAAT pLKO.1 531 CDS 100% 4.950 2.475 Y PDE4DIP n/a
4 TRCN0000048838 GCTAAGTATCTGGCATGTGTT pLKO.1 1101 3UTR 100% 4.950 2.475 Y PDE4DIP n/a
5 TRCN0000048842 GAAGGAGAACTTCAGCCTCAA pLKO.1 350 CDS 100% 4.050 2.025 Y PDE4DIP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001002810.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11397 pDONR223 100% 95.1% 92% None (many diffs) n/a
2 ccsbBroad304_11397 pLX_304 0% 95.1% 92% V5 (many diffs) n/a
3 TRCN0000473601 TCACCCAGAGTGGGACCCCTTAAC pLX_317 81.1% 95.1% 92% V5 (many diffs) n/a
4 ccsbBroadEn_15673 pDONR223 0% 92.9% 91.8% None 74G>T;146T>C;519_519delGins37 n/a
5 ccsbBroad304_15673 pLX_304 0% 92.9% 91.8% V5 74G>T;146T>C;519_519delGins37 n/a
6 TRCN0000480000 TACACGGTCCCAAACAGCCATTTC pLX_317 77.2% 92.9% 91.8% V5 74G>T;146T>C;519_519delGins37 n/a
7 ccsbBroadEn_07461 pDONR223 100% 53.4% 52.2% None (many diffs) n/a
8 ccsbBroad304_07461 pLX_304 0% 53.4% 52.2% V5 (many diffs) n/a
9 TRCN0000472710 GAATTCGTGAGATAATCGGGTTTT pLX_317 41.8% 53.4% 52.2% V5 (many diffs) n/a
Download CSV