Transcript: Human XM_011510179.1

PREDICTED: Homo sapiens phosphodiesterase 4D interacting protein (PDE4DIP), transcript variant X43, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PDE4DIP (9659)
Length:
8263
CDS:
195..7232

Additional Resources:

NCBI RefSeq record:
XM_011510179.1
NBCI Gene record:
PDE4DIP (9659)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510179.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048839 CGGAACATTGAGCTGAAGGTT pLKO.1 333 CDS 100% 3.000 2.100 N PDE4DIP n/a
2 TRCN0000048840 CGAGAACTCCAGGACAAGAAA pLKO.1 372 CDS 100% 5.625 2.813 Y PDE4DIP n/a
3 TRCN0000048841 GAGAATCTCAACAGTCAGAAT pLKO.1 423 CDS 100% 4.950 2.475 Y PDE4DIP n/a
4 TRCN0000048842 GAAGGAGAACTTCAGCCTCAA pLKO.1 242 CDS 100% 4.050 2.025 Y PDE4DIP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510179.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07462 pDONR223 100% 35.9% 31% None (many diffs) n/a
2 ccsbBroad304_07462 pLX_304 0% 35.9% 31% V5 (many diffs) n/a
3 TRCN0000473671 ATACATCCAACTTCAGTAGTATCG pLX_317 9.4% 35.9% 31% V5 (many diffs) n/a
4 ccsbBroadEn_15673 pDONR223 0% 7.6% 7.4% None (many diffs) n/a
5 ccsbBroad304_15673 pLX_304 0% 7.6% 7.4% V5 (many diffs) n/a
6 TRCN0000480000 TACACGGTCCCAAACAGCCATTTC pLX_317 77.2% 7.6% 7.4% V5 (many diffs) n/a
7 ccsbBroadEn_11397 pDONR223 100% 7.2% 6.9% None (many diffs) n/a
8 ccsbBroad304_11397 pLX_304 0% 7.2% 6.9% V5 (many diffs) n/a
9 TRCN0000473601 TCACCCAGAGTGGGACCCCTTAAC pLX_317 81.1% 7.2% 6.9% V5 (many diffs) n/a
10 ccsbBroadEn_07461 pDONR223 100% 6.7% 6.5% None (many diffs) n/a
11 ccsbBroad304_07461 pLX_304 0% 6.7% 6.5% V5 (many diffs) n/a
12 TRCN0000472710 GAATTCGTGAGATAATCGGGTTTT pLX_317 41.8% 6.7% 6.5% V5 (many diffs) n/a
Download CSV