Construct: ORF TRCN0000472865
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002154.1_s317c1
- Derived from:
- ccsbBroadEn_11615
- DNA Barcode:
- TACTCTGCCACCAAGTCTGACCAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GPR176 (11245)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472865
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 11245 | GPR176 | G protein-coupled receptor 176 | NM_001271854.2 | 99.9% | 99.8% | 230A>G |
| 2 | human | 11245 | GPR176 | G protein-coupled receptor 176 | NM_007223.3 | 97.1% | 96.5% | (many diffs) |
| 3 | human | 11245 | GPR176 | G protein-coupled receptor 176 | XM_011521167.3 | 89.6% | 84.6% | (many diffs) |
| 4 | human | 11245 | GPR176 | G protein-coupled receptor 176 | XM_011521168.3 | 89.6% | 84.6% | (many diffs) |
| 5 | human | 11245 | GPR176 | G protein-coupled receptor 176 | XM_017021873.2 | 89.6% | 84.6% | (many diffs) |
| 6 | human | 11245 | GPR176 | G protein-coupled receptor 176 | NM_001271855.2 | 87.7% | 86.9% | (many diffs) |
| 7 | human | 11245 | GPR176 | G protein-coupled receptor 176 | XM_017021874.2 | 68.4% | 68.4% | 0_1ins486 |
| 8 | human | 11245 | GPR176 | G protein-coupled receptor 176 | XM_017021875.2 | 68.4% | 68.4% | 0_1ins486 |
| 9 | human | 11245 | GPR176 | G protein-coupled receptor 176 | XM_017021876.1 | 68.4% | 68.4% | 0_1ins486 |
| 10 | human | 11245 | GPR176 | G protein-coupled receptor 176 | XM_017021877.1 | 68.4% | 68.4% | 0_1ins486 |
| 11 | human | 11245 | GPR176 | G protein-coupled receptor 176 | XM_017021878.2 | 68.4% | 68.4% | 0_1ins486 |
| 12 | human | 11245 | GPR176 | G protein-coupled receptor 176 | XM_024449835.1 | 68.4% | 68.4% | 0_1ins486 |
| 13 | mouse | 381413 | Gpr176 | G protein-coupled receptor 176 | NM_201367.3 | 84.1% | 86.6% | (many diffs) |
| 14 | mouse | 381413 | Gpr176 | G protein-coupled receptor 176 | XM_011239648.2 | 75% | 78.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1608
- ORF length:
- 1542
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg acataacggg agctggatct ctccaaatgc cagcgagccg cacaacgcgt 121 ccggcgccga ggctgcgggt gtgaaccgca gcgcgctcgg ggagttcggc gaggcgcagc 181 tgtaccgcca gttcaccacc accgtgcagg tcgtcatctt cataggctcg ctgctcgagt 241 ttggcaacat ggaggtcact agaaaacttg ataagagcag actgcctggg attaggttca 301 ttaaaaacct ggcctgctcg gggatttgtg ccagcctggt ctgtgtgccc ttcgacatca 361 tcctcagcac cagtcctcac tgttgctggt ggatctacac catgctcttc tgcaaggtcg 421 tcaaattttt gcacaaagta ttctgctctg tgaccatcct cagcttccct gctattgctt 481 tggacaggta ctactcagtc ctctatccac tggagaggaa aatatctgat gccaagtccc 541 gtgaactggt gatgtacatc tgggcccatg cagtggtggc cagtgtccct gtgtttgcag 601 taaccaatgt ggctgacatc tatgccacgt ccacctgcac ggaagtctgg agcaactcct 661 tgggccacct ggtgtacgtt ctggtgtata acatcaccac ggtcattgtg cctgtggtgg 721 tggtgttcct cttcttgata ctgatccgac gggccctgag tgccagccag aagaagaagg 781 tcatcatagc agcgctccgg accccacaga acaccatctc tattccctat gcctcccagc 841 gggaggccga gctgcacgcc accctgctct ccatggtgat ggtcttcatc ttgtgtagcg 901 tgccctatgc caccctggtc gtctaccaga ctgtgctcaa tgtccctgac acttccgtct 961 tcttgctgct cactgctgtt tggctgccca aagtctccct gctggcaaac cctgttctct 1021 ttcttactgt gaacaaatct gtccgcaagt gcttgatagg gaccctggtg caactacacc 1081 accggtacag tcgccgtaat gtggtcagta cagggagtgg catggctgag gccagcctgg 1141 aacccagcat acgctcgggt agccagcTCC TGGAGATGTT CCACATTGGG CAGCAGCAGA 1201 TCTTTAAGCC CACAGAGGAT GAGGAAGAGA GTGAGGCCAA GTACATTGGC TCAGCTGACT 1261 TCCAGGCCAA GGAGATATTT AGCACCTGCC TGGAGGGAGA GCAGGGGCCA CAGTTTGCGC 1321 CCTCTGCCCC ACCCCTGAGC ACAGTGGACT CTGTATCCCA GGTGGCACCG GCAGCCCCTG 1381 TGGAACCTGA AACATTCCCT GATAAGTATT CCCTGCAGTT TGGCTTTGGG CCTTTTGAGT 1441 TGCCTCCTCA GTGGCTCTCA GAGACCCGAA ACAGCAAGAA GCGGCTGCTT CCCCCCTTGG 1501 GCAACACCCC AGAAGAGCTG ATCCAGACAA AGGTGCCCAA GGTAGGCAGG GTGGAGCGGA 1561 AGATGAGCAG AAACAATAAA GTGAGCATTT TTCCAAAGGT GGATTCCTAC CCAACTTTCT 1621 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1681 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1741 GTGGAAAGGA CGATACTCTG CCACCAAGTC TGACCAAACG CGTTAAGTCg acaatcaacc 1801 tctggattac aaaatttgtg aaagatt