Transcript: Human XM_011527508.2

PREDICTED: Homo sapiens dermokine (DMKN), transcript variant X20, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DMKN (93099)
Length:
1938
CDS:
204..1619

Additional Resources:

NCBI RefSeq record:
XM_011527508.2
NBCI Gene record:
DMKN (93099)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527508.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139440 CGTCACATACACCAGCATCTT pLKO.1 1805 3UTR 100% 4.950 6.930 N DMKN n/a
2 TRCN0000140147 GAAGATGTCATTCGACACGGA pLKO.1 555 CDS 100% 0.660 0.924 N DMKN n/a
3 TRCN0000443689 GAAACACTGGGCACGAGATTG pLKO_005 523 CDS 100% 10.800 7.560 N DMKN n/a
4 TRCN0000438594 TGAGAGCCAGCAACCAGAATG pLKO_005 862 CDS 100% 10.800 7.560 N DMKN n/a
5 TRCN0000139439 CGACTCTGGGAGGATTTCAAA pLKO.1 1326 CDS 100% 5.625 3.938 N DMKN n/a
6 TRCN0000140170 GCAGGCAGCTTTGGAATGAAT pLKO.1 744 CDS 100% 5.625 3.938 N DMKN n/a
7 TRCN0000122009 GCTTGTCTCTCCTTGTTTCTT pLKO.1 1748 3UTR 100% 5.625 3.938 N DMKN n/a
8 TRCN0000122463 GCCACAATGGTGCTTGGGAAA pLKO.1 613 CDS 100% 4.050 2.835 N DMKN n/a
9 TRCN0000122587 CCAGCTTGTCTCTCCTTGTTT pLKO.1 1745 3UTR 100% 5.625 3.375 N DMKN n/a
10 TRCN0000145590 CTTTGACACTTTCTGGAAGAA pLKO.1 1214 CDS 100% 4.950 2.970 N DMKN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527508.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14344 pDONR223 100% 87.3% 86.7% None (many diffs) n/a
2 ccsbBroad304_14344 pLX_304 0% 87.3% 86.7% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000472993 CGTTCACGTTGTCCTAATTAACGG pLX_317 24.7% 87.3% 86.7% V5 (not translated due to frame shift) (many diffs) n/a
4 ccsbBroadEn_12988 pDONR223 100% 29% 28.8% None 1_1002del;1223A>C n/a
5 ccsbBroad304_12988 pLX_304 0% 29% 28.8% V5 1_1002del;1223A>C n/a
6 TRCN0000470141 CATAAGGCAAACTACTATTTATTA pLX_317 93.5% 29% 28.8% V5 1_1002del;1223A>C n/a
Download CSV