Transcript: Human XM_024451779.1

PREDICTED: Homo sapiens dermokine (DMKN), transcript variant X34, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DMKN (93099)
Length:
874
CDS:
184..555

Additional Resources:

NCBI RefSeq record:
XM_024451779.1
NBCI Gene record:
DMKN (93099)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451779.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139440 CGTCACATACACCAGCATCTT pLKO.1 741 3UTR 100% 4.950 6.930 N DMKN n/a
2 TRCN0000139439 CGACTCTGGGAGGATTTCAAA pLKO.1 304 CDS 100% 5.625 3.938 N DMKN n/a
3 TRCN0000121770 CGATCAGAACTACAATTACAA pLKO.1 405 CDS 100% 5.625 3.938 N DMKN n/a
4 TRCN0000122009 GCTTGTCTCTCCTTGTTTCTT pLKO.1 684 3UTR 100% 5.625 3.938 N DMKN n/a
5 TRCN0000122587 CCAGCTTGTCTCTCCTTGTTT pLKO.1 681 3UTR 100% 5.625 3.375 N DMKN n/a
6 TRCN0000145590 CTTTGACACTTTCTGGAAGAA pLKO.1 192 CDS 100% 4.950 2.970 N DMKN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451779.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12988 pDONR223 100% 89.5% 89% None 221A>C;226_227ins42 n/a
2 ccsbBroad304_12988 pLX_304 0% 89.5% 89% V5 221A>C;226_227ins42 n/a
3 TRCN0000470141 CATAAGGCAAACTACTATTTATTA pLX_317 93.5% 89.5% 89% V5 221A>C;226_227ins42 n/a
4 ccsbBroadEn_14344 pDONR223 100% 25.7% 25.2% None 0_1ins1059;221A>C;360delG n/a
5 ccsbBroad304_14344 pLX_304 0% 25.7% 25.2% V5 (not translated due to frame shift) 0_1ins1059;221A>C;360delG n/a
6 TRCN0000472993 CGTTCACGTTGTCCTAATTAACGG pLX_317 24.7% 25.7% 25.2% V5 (not translated due to frame shift) 0_1ins1059;221A>C;360delG n/a
Download CSV