Construct: ORF TRCN0000473283
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017313.1_s317c1
- Derived from:
- ccsbBroadEn_09203
- DNA Barcode:
- TGGGTATCGATTTTTACGGAAGGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LYZL1 (84569)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473283
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 84569 | LYZL1 | lysozyme like 1 | XM_005252627.3 | 90.2% | 86.7% | (many diffs) |
| 2 | human | 84569 | LYZL1 | lysozyme like 1 | XM_017016791.1 | 81.3% | 70.7% | (many diffs) |
| 3 | human | 119180 | LYZL2 | lysozyme like 2 | XM_011519307.2 | 80.5% | 74.7% | (many diffs) |
| 4 | human | 119180 | LYZL2 | lysozyme like 2 | XM_011519306.2 | 79.2% | 75.2% | (many diffs) |
| 5 | human | 84569 | LYZL1 | lysozyme like 1 | NM_032517.6 | 75.7% | 75.2% | (many diffs) |
| 6 | human | 119180 | LYZL2 | lysozyme like 2 | NM_183058.3 | 74% | 73.7% | (many diffs) |
| 7 | human | 119180 | LYZL2 | lysozyme like 2 | XR_930469.2 | 72% | (many diffs) | |
| 8 | human | 84569 | LYZL1 | lysozyme like 1 | XR_428650.1 | 60.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 648
- ORF length:
- 582
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca ggacgctccc ctgagctgcc tgtcaccgac taggtggagc agtgtttctt 121 ccgcagactc aactgagaag tcagcctctg gggcaggcac caggaatctg ccttttcagt 181 tctgtctccg gcaggctttg aggatgaagg ctgcgggcat tctgaccctc attggctgcc 241 tggtcacagg cgccgagtcc aaaatctaca ctcgttgcaa actggcaaaa atattctcga 301 gggctggcct ggacaattac tggggcttca gccttggaaa ctggatctgc atggcatatt 361 atgagagcgg ctacaacacc acagccccga cggtcctgga tgacggcagc atcgactatg 421 gcatcttcca gatcaacagc ttcgcgtggt gcagacgcgg aaagctgaag gagaacaacc 481 actgccatgt cgcctgctca gccttgatca ctgatgacct cacagatgca attatctgtg 541 ccGGAAAAAT TGTTAAAGAG ACACAAGGAA TGAACTATTG GCAAGGCTGG AAGAAACATT 601 GTGAGGGCAG AGACCTGTCC GAGTGGAAAA AAGGCTGTGA GGTTTCCTAC CCAACTTTCT 661 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 721 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 781 GTGGAAAGGA CGATGGGTAT CGATTTTTAC GGAAGGCACG CGTTAAGTCg acaatcaacc 841 tctggattac aaaatttgtg aaagatt