Transcript: Human NM_032517.6

Homo sapiens lysozyme like 1 (LYZL1), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
LYZL1 (84569)
Length:
806
CDS:
187..633

Additional Resources:

NCBI RefSeq record:
NM_032517.6
NBCI Gene record:
LYZL1 (84569)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032517.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049551 GCAATTATCTGTGCCAGGAAA pLKO.1 511 CDS 100% 4.950 3.465 N LYZL1 n/a
2 TRCN0000372953 AGGCTGTGAGGTTTCCTAAAC pLKO_005 615 CDS 100% 10.800 6.480 N LYZL1 n/a
3 TRCN0000372954 ATGACGGCAGCATCGACTATG pLKO_005 383 CDS 100% 10.800 5.400 Y LYZL1 n/a
4 TRCN0000378909 ATTATGAGAGCGGCTACAACA pLKO_005 341 CDS 100% 4.950 2.475 Y LYZL1 n/a
5 TRCN0000049549 CGGAAAGCTGAAGGAGAACAA pLKO.1 441 CDS 100% 4.950 2.475 Y LYZL1 n/a
6 TRCN0000156017 CGGAAAGCTGAAGGAGAACAA pLKO.1 441 CDS 100% 4.950 2.475 Y LYZL2 n/a
7 TRCN0000049552 CAAGGAATGAACTATTGGCAA pLKO.1 547 CDS 100% 2.640 1.320 Y LYZL1 n/a
8 TRCN0000150392 CAAGGAATGAACTATTGGCAA pLKO.1 547 CDS 100% 2.640 1.320 Y LYZL2 n/a
9 TRCN0000153636 CATCTTCCAGATCAACAGCTT pLKO.1 405 CDS 100% 2.640 1.320 Y LYZL2 n/a
10 TRCN0000049548 CCTTGGAAACTGGATCTGCAT pLKO.1 315 CDS 100% 2.640 1.320 Y LYZL1 n/a
11 TRCN0000154336 CCTTGGAAACTGGATCTGCAT pLKO.1 315 CDS 100% 2.640 1.320 Y LYZL2 n/a
12 TRCN0000155683 CTTCAGCCTTGGAAACTGGAT pLKO.1 309 CDS 100% 2.640 1.320 Y LYZL2 n/a
13 TRCN0000049550 GCGGGCATTCTGACCCTCATT pLKO.1 196 CDS 100% 1.650 0.825 Y LYZL1 n/a
14 TRCN0000153269 GAATGAACTATTGGCAAGGCT pLKO.1 551 CDS 100% 0.750 0.375 Y LYZL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032517.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09203 pDONR223 100% 76.1% 75.7% None 0_1ins138;185A>C n/a
2 ccsbBroad304_09203 pLX_304 0% 76.1% 75.7% V5 0_1ins138;185A>C n/a
3 TRCN0000473283 TGGGTATCGATTTTTACGGAAGGC pLX_317 19.2% 75.7% 75.2% V5 (many diffs) n/a
4 ccsbBroadEn_09459 pDONR223 100% 74.3% 74.2% None (many diffs) n/a
5 ccsbBroad304_09459 pLX_304 0% 74.3% 74.2% V5 (many diffs) n/a
6 TRCN0000481443 ACTATCGTGGTCGGAACCGGTAAA pLX_317 72.4% 74.3% 74.2% V5 (many diffs) n/a
Download CSV